International Journal of

Drug Delivery Technology

ISSN: 0975 4415

Peer Review Journal

Menu

Disclimer: Scopus and Crossref are registered trademark of respective companies.

This journal is member of Crossref. 

1. Synthesis, identification, and using of new nitro hydrazone ligand in spectrophotometric quantification of Co(II) content in vitamin B12 injections
Suhair Mohammed Yaseen, Bushra Basheer Qassim, Naeemah Owayed Al-Lami
Abstract
Nitro Schiff base ligand of 2-(biphenyl-4-yl)-3-((2-(2,4-dinitrophenyl) hydrazono)methyl)imidazo[1,2-a]pyridine was synthesized, identified, and used as a new reagent in Co(II) spectrophotometric determination of vitamin B12 injection samples by standard addition technique at 530nm with the recovery of  98-102% and relative error percent of 0-1.3%. The analytical reaction parameters were studied to optimize the analytical conditions of the proposed method. The suggested method performed linearity in the range 25-250 ppm, LoD= 0.193, LoQ= 0.638ppm, and molar absorptivity constant of 238M-1.cm-1. The formed complex’s mole ratio composition was 2:1 of BDNHMIP: Co(II) with a stability constant of 0.519×107.

2. Evaluation the side effects of oral contraceptive pills on women in Al-Kut City, Iraq
Tayseer Shamran Al-Deresawi, Akmam Ali Habeeb
Abstract
The present work was initiated to explore if the contraceptive pills of the generic names, Yasmin and Microgynon (Germany), place some side effects on consumers, women, in Al-Kut City, Iraq. Here, blood samples were collected from 31 consuming women (CW) and 18 non-consuming women (NCW), as a control group. A questionnaire and hormonal (follicle-stimulating hormone (FSH), luteinizing hormone (LH), and estrogen hormone (EH)) tests were used to uncover the presence of side effects. The results of the questionnaire showed side effects of emotional changes (31%), headache and nausea (14%), depression (12%), hormonal disorder (20%), heavy vaginal bleeding between periods (9%), and overweight (14%). The FSH and LH levels revealed significant (p≤0.05) decreases in the CW group compared with those in the NCW group. However, the EH levels’ results demonstrated significant (p ≤0.05) increases in the CW group compared with those in the NCW group. The present investigational study indicates that the contraceptive pills of the generic names, Yasmin and Microgynon (made in Germany), place side effects on consumers, women, in Al-Kut City, Iraq.

3. Evaluation of the Antibacterial Activity and Immunomodulatory Effect of Purified Exopolysaccharides( EPSs ) Produced from Vancomycin Resistant Enterococcus faecalis
Saif Mazeel Abed, Rajwa Hasen Essa, Kadhim Hashim Yaseen Alaraji
Abstract
This study was carried out evaluation the antibacterial activity of purified Effect of Purified Exopolysaccharides( EPSs ) from vancomycin-resistant Enterococcus faecalis against gram-positive bacteria  Staphylococcus aureus, and gram-negative bacteria  Proteus mirabilis, Pseudomonas aeruginosa  as well as evaluation the immunomodulatory effect on the immunity system, a total 100 the urinary tract infection sample was contained 1%  vancomycin-resistant E. faecalis.  Moreover, the total carbohydrates contents of purified  EPSs was  88% expressed as a percentage of EPS dry weight (w/w%), the results of antibacterial activity displayed the  EPSs has activity against studied isolates depending on inhibition zone diameter at 0.5 mg/mL and 1 mg/mL concentration, but fewer inhibition zones in both concentrations were recorded in S. aureus, at 0.5 mg ̸mL was (7 mm), and 1 mg ̸ml was (8 mm). Furthermore, the highest inhibition zone was recorded in P. mirabilis at  0.5  mg ̸ ml was (17 mm), 1 mg ̸mL was (20 mm); on the other side, the in vitro experiments revealed EPSs acted positively on the immunity system in the group that was  injected with EPS combination with S. aureus and the highest value was recorded in the group received 1 mg/ml concentration combination with S. aureus in all assays as following TLR-2 level was (8.733  ± 2.136) with significant differences at (p ≤ 0.05 )  comparison with other groups,  while phagocytic activity was (24.2%) as well as IL-10 level was (78.12 ± 3.16),significant different at (p ≤ 0.05), whoever Arthus reaction recorded highest results at 1mg/ml (4.26 ± 0.05) Furthermore delayed hypersensitivity test was reported (4.14 ± 0.00 , 4.24± 0.00, 3.50 ± 0.50) after 24 hr, 48  hr, and 72 hr respectively in the same group. Depending on obtained results in this present study, the (EPSs)  produced by Vancomycin-Resistant E. faecalis  appeared an antibacterial activity against gram-positive and negative bacteria in vitro, also the in vivo experiments showed  EPSs worked positively on the immunity system.

4. Synthesis , Characterization and polymerization of 1Hpyrazolo[1,2-b]phthalazine-5,10-dione derivatives Using CuO nanoparticle Oxide from Natural Source as Catalyst
Marwa Ata Abd Alsaheb; Sanaa A. Alsahib
Abstract
Copper Oxide (CuO) nanoparticles (NPs) of 17-22 nm size have been synthesized from Syzygium aromaticum (Eugenia caryophyllus). The resulting Nanoparticles have been described by FTIR spectroscopy, X-ray diffraction and Transmission electron microscopy. The CuO NPs was used as a nano catalyst for synthesis and polymerization of 1Hpyrazolo[1,2-b]phthalazine-5,10-dione derivatives by a three-component coupling reaction between aldehydes, 5,5-diethyl-2,3-dihydrophthalazine-1,4(5H,8H)-dione and malononitrile . They have good catalytic activity with outstanding yields. Significant features of Copper Oxide nanoparticles (CuO NP) as a catalyst. Reaction time, higher yields, simple chemical separation, catalytic economic efficiency, quick process and no harmful by-products. Using spectroscopic methods (FTIR, 1H-NMR spectral), new derivatives of synthesized compounds were verified, and physicochemical experiments were examined. The action of these compounds was then tested as a possible antibacterial against various forms of pathogenic bacterial isolates and too as acute toxicity.

5. Study the Effects of some Neuroleptic Drugs on the Haloperidol-induced tardive dyskinesia in male mice
Huda R. Atiyah , Selman M. Selman ,  Alaa J. Mahrath
Abstract
Tardive dyskinesia (TD) is a neurological iatrogenic disorder and is one of the neurodegenerative movement syndromes affecting mainly orofacial region which includes vacuous chewing movements (VCMs), tongue protrusion (TP), and facial jerking (FJ), resulting from chronic neuroleptic treatment of schizophrenia. The aims of this paper are to evaluate the effects of some a typical neuroleptic drug (risperidone, olanzapine, and aripiprazole) to reduce the TD in mice and study the effects of these drugs on dopamine levels in the brain, see Scheme 1. Adult, albino mice were enrolled in this experiment. The animals were randomly divided into five groups ,each group has 10 mices . Each mouse of group1 received normal saline in equal volume to the haloperidol dose intraperitoneally (IP) for 21 days. Each mouse of group 2,3,4 and 5 received haloperidol 2 mg/kg IP for 21 days. mices of group 3,4 and 5 received risperidone 1 mg/kg, olanzapine 2.5 mg/kg, aripiprazole 3 mg/kg orally by gastric tube respectively for 3 days. On the 25th day, each mouse was placed in the glass box for 10 minutes, and VCM was recorded by video camera. Then each mouse of the whole groups was decapitated and the brain were removed from the skull for measurement of dopamine(DA). Dopamine level decreased significantly in group 2 as compared with group1 (p <0.05 ), there were significant increase in the DA levels between group 3 and group 4 as compared with group 2 (p >0.05), but there were  no significant differences between group 5 as compared with group 2 (p >0.05). VCM increased significantly in group 2 as compared with group1 (p <0.05). VCM decreased significantly in  group 3 and 4 as compared with group 2 (p <0.05), but there were no significant differences between group 5 as compared with group 2 (p >0.05).

6. Preparation, Characterization, And In-Vitro Evaluation Of Tenoxicam-Paracetamol Cocrystal
Ahmed A. Albadri , Marwan I Jihad , Zainab A. Radhi
Abstract
Crystallization is a promising approach in enhancing drug solubility and dissolution. The objective of this study was to prepare and evaluate tenoxicam co-crystals with paracetamol as a co-former. Co-crystals of tenoxicam-paracetamol were prepared by solvent evaporation technique and grinding method; three ratios of the drug to conformer were used (1:1, 1:2, and 1:4). The tenoxicam-paracetamol co-crystal was characterized by determining the melting point Fourier transform infrared spectroscopy, powder X-ray diffraction, and Scanning electron microscopy. The co-crystals were evaluated for the drug solubility and dissolution, the content of tenoxicam within the co-crystals was also determined. The formula with the ratio (1:2) tenoxicam to paracetamol that was prepared by solvent evaporation technique had a different melting point than that of the pure drug and of the conformer, the Fourier transform infrared spectroscopy analysis indicated the formation of hydrogen bond and the powder X-ray diffraction pattern of the co-crystal showed a unique Powder X-ray diffraction pattern distinguishable from that of tenoxicam and paracetamol. The formula with the ratio (1:2) tenoxicam to paracetamol that was prepared by solvent evaporation technique showed the best enhancement in drug solubility and dissolution compared to the other formulae. In conclusion, solvent evaporation technique and the ratio of (1:2) tenoxicam to paracetamol are more efficient in enhancing drug solubility and dissolution than the grinding method and other ratios used, respectively.

7. Formulation and evaluation of Nimodipine Nanoparticles incorporated within Orodispersible tablets
Areej W. Alhagiesa  Mowafaq M. Ghareeb
Abstract
Nimodipine (NMD) is a Dihydropyridine calcium channel blocker with some selectivity to the cerebral vasculature administered to minimize the neural deficit for patients with subarachnoid hemorrhage. The NMD is characterized by low bioavailability because of its low water solubility and extensive first-pass metabolism. This research aims to improve bioavailability by enhancing the solubility via the formulation of nanoparticles (NPs) and decreasing the first-pass metabolism by incorporation the prepared NMD NPs in Orodispersible Tablets (ODTs). The preparation of NMDNPs was done by solvent antisolvent precipitation technique using three different stabilizers ( TPGS, Soluplus®, and PXM 407 ) in two drugs: stabilizer ratios (1:2 and 1:3) and two different injection speed (30 and 60 mL/hr) of the solvent to the antisolvent phase. The optimized formula is composed of 30 mg NMD, 60 mg Soluplus® and 1% w/w mannitol as cryoprotectant. The degree of crystallinity of pure NMD and NMD NPs was examined by X-ray diffraction. It was established that the degree of crystallinity had been reduced, which is an indication of converting the crystalline NMD into a more amorphous form. ODTs incorporating NMD NPs show a complete dissolution after forty minutes in SSF with 0.5 % Brij-35 compared with ODT incorporating pure NMD, which reaches only 50% in the same duration. It is concluded that formulation NMD as NPs to be incorporated in ODT is an excellent technique to enhance the dissolution rate and promoting pre-gastric absorption.

8. Synthesis and characterization of (3-ethanethioate-4-N- cyclic imide-5- aryl)-1,2,4-triazole and study anticancer and antioxidant
Bahaa Fadhil Hamzah and Entesar O. Al-Tamimi
Abstract
New derivatives of 5-aryl-4-amino-3-thio- 1,2,4- triazole (a-d) were prepared from fusion subs. benzoic acids with thiocarbohydrazide. Then reacted with different cyclic anhydrides via stirring to give amic acid of 1,2,4-triazole (1-20). Compounds (1-20) convert to N-cyclic imides of subs. -1,2,4- triazole (21-40) by using acetic anhydride and anhydrous sodium as a water drawer agent (21-40). Conclusion: Physical properties identified all prepared compounds, Fourier transform infrared spectroscopy (FTIR), 1H-NMR for some of them, anticancer and antioxidant applications were measured.

9.  Effect of Vitamin D, Calcium and Phosphate on The Low Back Pain
Jawad K. Muraih, Tamadhr J. M. Alsalman, Abdulhussien Mahdi Aljebory, Mays Ali Thamer and Faid Kamel Hasoon
Abstract
Objective: We have aimed to analyze and examine the relationship between varied levels of vitamin D, Ca+2 and PO4-3 in the serum of patients suffering particularly from chronic low back pain and further to investigate its impact on pain and even on functional capacity. Methods: serum of 150 patients (70 female and 80 male) with, aged between 35 and 60 years, was participated in the study. Control group include 100 healthy volunteers. Level of vitamin D estimated using ELIZA kits while Ca2+ and PO4-3 level were measured by spectrophotometer. Results: results indicate that all patients have low level of vitamin D (21ng\ml) when compared to the normal subjects (62.8 ng\ml) with p- value 6E-05. while for Ca2+ level was equal to (7.95ng\ml) refereed to low than that of normal subjects (11.97 ng\ml) with P – value 0.0534 and (0.33 ng\ml) for PO4-3concentration compared with (0.09 ng\ml) for normal human (P – value 0.01). Conclusion: Vitamin D deficiency may be referred to man cause of low back pain, Vitamin D levels should be observed in patients with musculoskeletal pain at risk of Vit D deficiency. Vitamin D levels can used for Diagnostic study.

10. Simple green method high throughput flow injection technique for spectrophotometry determination of Fe (III) in Iron drugs through the reaction between DPA-4-Sulfonat with hydrogen peroxide using a modified detection unit.
Bushra B. Qassim1, Luma L. Hamed
Abstract
A new simplicity, accuracy, rapid and sensitive batch and merging zones / flow injection analysis spectrophotometric ways for estimation of Fe (III) as ferric chloride in pure pharmaceutical formulations. The method was based on oxidation-reduction between diphenylamino-4-solfonic acid sodium salt (DPA-4-SA) with hydrogen peroxide (H2O2). Ferric chloride was behave as the catalytic effect on this reaction. The measurements were taken at 504 nm, after the reaction was monitored spectrophotometry, a purple-pink complex was formed after 5 min at 25-30° C. The optimized FIA order was able to estimate of Fe (III) with throughput 82 sample/h, flow rate 1.92 mL/min was used distilled water as a carrier, 78.50 μL analyte (60 μg/mL Fe (III)) and DPA-4-SA(1.5×10-3 M) volume, 7 M H2O2 (58.875 μL) for L1 and L2, respectively. The colored product showed Beer’s Law in the range of concentration 2-30 and 3-75 μg/mL and detection limits 1.60, 9.57×10-4 μg/mL for batch and FIA/ MZ methods, respectively. Repeatability (RSD %) (n =7) were 0.03 and 0.02 for estimation of ferric with concentration 25 &50 μg/mL by FIA/MZ method. The open valve was selected as an ideal injection time to finish transporting the sample from the sample loop to the flow cell. The developed CFIA procedure was applied easily and successfully for the quantitative determination of ferric in marketed pharmaceutical preparations without interference from extractable tablet additives and statistical analysis of values comparing with results by united state pharmacopoeia (USP) were also reported.

11. Thrombolytic Activity of Purified Staphylokinase Produced from Clinical Isolates
Luma Saleem Hachim, Khawlah Jebur Khalaf, Ikbal Khudhur Aljoofy
Abstract
The present study is designed for the screening of staphylokinase producing Staphylococcus aureus which is isolated from different clinical sources. Mannitol salt agar and Blood agar were used to isolate the Staphylococcus aureus. On the other hand, 40(66.6 %) Staphylococcus aureus could develop production staphylokinase by casein hydrolysis assay and 45 (75%) by heated plasma agar assay. While Satoh’s media is the best media for staphylokinase production, the period 24 hours was optimum incubation on the staphylokinase production. Using the casein digestion method was confirmed enzyme activity. Determined total protein content by the Bradford method. The first stage of purification of staphylokinase is ammonium sulphate precipitation in saturation 85% and dialysis, the second stage is ion-exchange chromatography and the end-stage is gel filtration chromatography. Increased effect thrombolytic activity for purified staphylokinase than of crude enzyme.

12. The Genetic sequence of Leishmania tropica among Patients with Cuotaneous leishmaniasis in Iraqi Patients
Zaynab Kh. Rasheed, Nazar Sh. Mohammed, Salwa Gh. Turki, Zaman Abdul-Sahib Abed
Abstract
The present study was carried out on a period from 15 st April 2017 to 30 th Mars 2018, 150 patients; their ages ranged from 5–74 years. They were 55 females and 95 males who were inhabitants of the urban and rural areas attending to dermatology department of hospitals at Baghdad city (AL-Yarmook Hospital, AL-Karamaa Hospital and AL-Karkh Teaching Hospitals). Patients of migratory camps in and around Baghdad city Diyala, Tikrit and Kirkuk Hospitals, suffering from skin lesions either single or multiple, were located on different parts of the body and were clinically diagnosed with cutaneous leishmaniasis. Results showed that samples in this study included 95 males (63.3%) and 55 females (36.7%), their age of all individuals ranged from 5 to 74 years with a median age of 32.9 ± 15.14 years. Moreover that and were 60 (40%) were urban, while 90 (60%) were rural residents. Forty-two (35%) patients had a single lesion, while 78 (65%) patients had multiple lesions demonstrated single and multiple lesions of cutaneous leishmaniasis for some patients. The gene sequence PCR products of, Ltropica-was: GGTGTCCGGCAGCTGGGACAACACCA TCAAGGTGTGGAACGTGAACGGGGCAAGTGTGAGC GCACGCTCAAGGGCCACAACTA CGTGTCCACGGTG in Amplicon Length: 205. Sequence FASTA files, which are used in the phylogenetic tree, it has been submitted to the bank’s General. Provide genome sequences it was presented sequence according to the guidance provided by the iInternet bank of Gene tool. The sequence analysis compares with the late transcription factor (VLTF-1) gene sequences from different pox Parra in databases using blast Online.

13. Synthesis and Characterization of Based on Some New Schiff base from 5-styryl-2-amino-1,3,4-thiadiazole
Noor Mohammed Jawad, Shetha Fadhil Narren
Abstract
The present study synthesized synthesis and characterization with studying biological activity of based on Schiff based from 5-styryl-2-amino -1,3,4-thiodizole [C1] from the reacting α-phenyl acrylic acid with thiosemicarbazide. Schiff bases [C2-C7] have been synthesized via compound (C1) reaction with a diverse aromatic aldehyde. Moreover, [C2, C3] reaction with distinct anhydrides (malic and succinic anhydride) as well as sodium azide have been given to oxazepine [C8-C10 ] and tetrazole [C11-C12] respectively. The prepared derivatives were The infrared spectra have been used to prepare the derivatives.

14. Enhancing Anti-fungal Activity and Bioavailability of Optimized Clotrimazole Transfersomal Gel for the Treatment of Transdermal Fungal Infection
Jamal Alyoussef Alkrad, Rashad M. Kaoud, Eman J. Heikal
Abstract
Objective: Clotrimazole (CTM) is an anti-fungal drug which is used in the treatment of candidiasis. The CTM’s poor skin permeability makes it a good candidate to be formulated as Transfersomes (TF) to increase skin permeability of CTM and enhance its anti-fungal activity. Methods: CTM-TF was formulated by using the lipid film hydration method. Different CTM-TF formulations have been characterized for the polydispersity index (PDI), vesicle size, zeta potential, entrapment efficiency (EE %), elasticity and quantity of CTM permeated through the skin to determine the optimized formula. The optimized formula was incorporated into the Hydroxypropyl methylcellulose (HPMC E15) gel base and compared to the reference product Canesten® cream 1% for spreadability, pH, viscosity, drug content, in-vitro and in-vivo anti-fungal activity, and bioavailability. Results: Different CTM-TF formulations have shown a small vesicle size varied from (64.52 ± 0.24 nm) to (84.42 ± 0.78 nm) with a high EE % ranged from (68.55 ± 0.45 %) to (90.56 ± 0.62%). The in-vitro release of the different formulae was inversely proportional to EE %. The kinetic analysis of the release data was best fitted to Higuchi’s diffusion model. CTM-TF gel showed higher anti-fungal activity compared to Canesten® cream 1%. The in-vivo pharmacokinetic study has proved that, CTM-TF gel had improved its bioavailability compared to Canesten® cream 1% through the skin. Conclusion: CTM-TF gel can penetrate a stratum corneum barrier with improved anti-fungal activity and bioavailability compared to market product.

15. Isolation of Staphylococcus aureus bacteria from nasal swabs from workers in restaurants in Kirkuk city
Marwa Jassim Mohammed, Aylan Arslan Ali
Abstract
One of the most important problems facing our time is the problem of resistance to various antibiotics, which is a global problem and among the most important types of resistant bacteria is the Staphylococcus aureus bacteria resistant to methicillin. In the current study, clindamycin induced resistance was investigated by a D-test method among methicillin-resistant staphylococcus isolates. As 100 samples were collected from the nose of restaurant workers in the city of Kirkuk, 30 samples were positive, including 16 MRSA samples and 14 MSSA samples. resistance in Staphylococcus aureus (MRSA & MSSA) to antimicrobial agent (53.33%) resistant to Methicillin, Cefoxitin, Ceftriaxone, Ceftazidime  . (63.33%) Vancomycin , (70%) Ciprofloxacin , (60%) Gentamicin , (43.33%) Azithromycin , (50%) Clindamycin ,  (43.33%) Trimethoprim , 66.66% Tetracycline.

16. Synthesis and Characterization of the Novel Compounds Containing Imidazole, Thiadiazole, Schiff Base, and Azetidinone Chromospheres as a New Antibacterial Agents
Mazin Nadhim Mosa, Roaa Salman Baiwn, Ali Khammas Mohammed
Abstract
In this study, a novel series of of 1-(4-substituted)-N-(5-((2,4,5-triphenyl-1H-imidazol-1-yl)methyl)-1,3,4-thiadiazol-2-yl)methanimine and 3-chloro-4-(4-substituted)-1-(5-((2,4,5-triphenyl-1H-imidazol-1-yl)methyl)-1,3,4-thiadiazol-2-yl)azetidin-2-one  derivatives were synthesized by the reaction of benzil with benzaldehyde in presence of ammonium acetate to get the imidazole derivatives. The imidazole intermediate then reacted with methyl chloroacetylchloride, thiosemicarbazide and sodium hydroxide respectively, to obtain 5-((2,4,5-triphenyl-1H-imidazol-1-yl)methyl)-1,3,4-thiadiazol-2-amine intermediate. Then, it will be converted into Schiff base derivatives which will be treated with chloroacetyl chloride to obtain the final products. The structures of the synthesized compounds were confirmed by the aid of 1HNMR, 13CNMR, mass spectroscopy and elemental analysis. In our conclusion, the antibacterial effects were tested with the use of tow Gram positive (Staphylococcus aureus and, Enterococcus facaels,), two gram negative (E. coli, Klebsiella pneumonia), and anaerobic (streptococcus. Pyogen)  bacteria.  Many synthesized compound concentrations were used and the findings were compared with expectations (cefixime and metronidazole). Some of the synthesized compounds demonstrate a considerable activity compared to the standards.

17. Synthesis of New Benzimidazole Containing Azoles Ring Moiety and Study their Biological Activity
Eman Mudher Esmail, Ziad T I Alkayar and Muayad Ahmed Rdaiaan
Abstract
This study provides a new library of benzimidazole derivatives containing azole ring moiety was synthesized via 1,3-dipolar cycloaddition. The obtained compounds were characterized by FT-infrared, 1H- and 13C- NMR spectroscopy. The biological activity was tested for most of the synthesized compounds against four types of bacteria two of them are gram-ve (E. coli and P. aeruginosa) and two gram+ve (B. subtilis and S. aureus). Indeed, the synthesized compounds show a good to moderate effect on both types of bacteria.

18. Evaluation the effect of alcoholic extract of Ruta graveolens plant on the histological structure of lungs in the rabbit
Rajaa S.Abbas, Ibtisam Khalaf Abd ali, Israa Abdulqader Abdulwahab, Thekra Atta Ibrahim
Abstract
The current study is aimed to find out the effect of Ruta graveolens alcohol extract on the histological structure of the lung in rabbits. The study includes the use of (8) rabbits, which were divided into three groups. The first group included a control group that was injected with a physiological saline solution (0.09% NaCl) while the second group is the group of rabbits that were injected with the alcohol extract by a concentration of 250 mg/kg. The third group’s rabbits were injected with an extract at a concentration of 500 mg/kg for thirty days for each concentration. The results of the current study showed that rabbits treated with an alcoholic extract of the Ruta graveolens plant at a concentration of 250 and 500 mg/kg and for a period of 30 days showed histological changes represented by the occurrence of degeneration and necrosis in the cells of the lining of some bronchi and the separation of some cells from the epithelial layer and the study showed in addition to that, changes in the endothelium lining the blood vessels inside the organ where deformity and congestion in the blood vessel are observed with the appearance of a blood clot inside the blood vessel and the emergence of fibrosis and infiltration of inflammatory cells around the vessel. Vesicular active transport vesicles appeared inside the vessels indicating the high effectiveness of the blood of blood vessels. The study showed that more severe degenerative changes occurred as the concentration of the extract increased on the lung, where a concentration of 500 mg/kg of the extract was observed and for a period of 30 days, increased necrosis and degeneration of the cells in the bronchioles and alveoli with the occurrence of the dissociation of the epithelial layer from the base membrane layer on which it is based and collected in the bronchiole.

19. Effect of Low Level Laser Irradiation on White and Red Blood Cells after Different Storage Periods
Huda Kadhem Mohseen, Kaiser N. Madlum and Haider Abd jabbar
Abstract
The aim of the present work was to investigate the effect of irritation with the He-Ne laser on the whole human blood cells. Samples were collected from healthy persons. Samples were divided into two groups: irradiation and control groups. irradiation groups received laser irradiation from He-Ne laser (30 mW) for 15 minutes. The results demonstrate that RBCs count start to decrease slightly after 6 hours of laser irradiation and significantly decreased after three weeks if irradiation followed by storage. Lymphocytes and T-cells counts showed sever dropping after 3 weeks of storage.

20. Normal Vaginal Delivery Versus Caesarean Section: A Comparative Study in Al-Nasiriya city, South of Iraq
Firas Fadhil Alyaseen, Suad Rodan Shwielf
Abstract
The term pregnancy, which is also known as gestation or gravidity, refers to the duration in which an embryo carries and develops within the woman’s body, and precisely, in her womb (uterus). However, it is called multiple pregnancies when more than one fetus involves. Pregnancy can be existed either by sexual connection or with the help of reproductive technology. Ordinarily, it endures around 40 weeks, or over 9 months, as determined from the last monthly period till delivery. On the other hand, the embryo can be defined as an evolving offspring over the first eight weeks post-conception; after that, it can be called a fetus till childbirth. The popular signs and symptoms of pregnancy might involve each of the missed period, inflated breasts, nausea with or without vomiting, repeated urination, and tiredness. A pregnancy test can be utilized for confirmation. The current study aimed to discuss the maternal medical outcomes after both: Caesarean section and natural vaginal childbirth. Results have shown that when the cases with cesarean and the normal delivery was compared in term of the adverse effects and the complications we find that there are no significant differences in term of normal blood loss while when the bleeding during and after delivery was investigated, we found the rate of it was significantly more in cesarean than in normal delivery, also fever was significantly higher in females who delivered in cesarean than who delivered with normal vaginal delivery. In conclusion, the incidence rate of cesarean section deliveries was increased compared to normal vaginal deliveries, so the complications and adverse effects that may be associated with the cesarean section need to be investigated and compared to what happens with normal vaginal delivery.

UGC approved Journal

This journal is present in UGC approved List of Journals for the purpose of Career Advancement Scheme (CAS) and Direct Recruitment of Teachers and other academic staff as required under the UGC (Minimum Qualifications for Appointment of Teachers and other Academic Staff in Universities and Colleges)

The publication is licensed under Creative Commons License  View Legal 

Published by International Society for Science and Nature