International Journal of

Drug Delivery Technology

ISSN: 0975 4415

Peer Review Journal

Menu

Disclimer: Scopus and Crossref are registered trademark of respective companies.

This journal is member of Crossref. 

1.Impact of Smoking and Passive Smoking Habit in the XRCC1 Arg399Gln and RAD-18 Arg302Gln Gene Polymorphisms in Type 1 Diabetes Mellitus Patients
Hadeel Alaa Al-Rrubaei, Methak J. Al-Jboori, Noora M. Hameed, Mona N. Al-Terehi
Abstract
Smoking is the most important habit problem in the world which contributed in disease development. The goal of the study is to detect the impact of the smoking habit in the XRCC1 Arg399Gln and RAD-18 Arg302Gln gene polymorphisms in type 1diabetes mellitus patients, the aims implemented by using polymerase chain reaction with confronting two-pair primers (PCR-CTPP) method and allele-specific PCR for genes. The results included 16% were smokers, and 12% of them were passive smokers. The polymorphisms of the XRCC1 gene show three genotyping (AG, GG, and AA) and two alleles (A and G), the GG was more frequent (60%) in patients than control (43.33%), and AG lower in patients (40%) than control (46.66%) (OR 1.312 P 0.619) and AA did not observe in patients, these differences were non-significant (OR 0.124, P 0.180). Another gene was RAD18 Arg302Gln (rs373572), three genotyping in this site of a gene (AA, AG, and GG) two of them were observed in the present study (AA and AG). GG did not observe non-significant differences (OR 0.22, P 0.34) of AA and AG and non-significant also with GG (OR 5, P 0.524). The effect of smoking habit included smoker, non-smoker, passive and non-passive smoker. The RAD18 gene did not show variation. The XRCC1 shows non-significant variations between non-smoker and smoker. The GG was more frequent (12%) than AG (4%) in smokers and also in non-smoker (44% and 40%) individuals. The passive smokers show non-significant differences also, 56% of non-passive smokers patients have GG (OR 0.3667, p = 0.4164) and 32% have AG, and 4%, 8% for passive smokers (OR 3.5000, p = 0.336). The present study concluded that the RAD18 and XRCC1 gene nor relation with DM type 1 neither associated with the smoking habit in diabetes mellitus (DM) type 1 patients.

2. Quantitative Estimation of Polyphenolic Biomarker Quercetin and Chlorogenic Acid in Moringa oleifera Leaves by Hyphenated High-Performance Thin-layer Chromatography (HPTLC) Techniques
Md. N. Alam, Rahul Kaushik, Lubhan Singh, Najam A. Khan
Abstract
Objective: Moringa oleifera possesses a wide range of biological activities and treats various ailments. A specific, sensitive, selective, precise, and reproducible High-performance thin-layer chromatography (HPTLC) -UV290nm method has been established and validated for instantaneous assessment of the two biomarker phytoconstituents quercetin (QC) and chlorogenic acid (CGAs) from ethanolic extract of M. oleifera (MO) leaves. Methods: Chromatography was performed on aluminum foil-backed silica gel 60 F254 HPTLC plates with the binary mobile phase Toluene: Ethyl acetate: Formic acid: Methanol (5.0:4.0:1.0.5.:0.5,v/v/v/v). Ultraviolet detection was performed densitometrically at the maximum absorbance wavelength, 290nm. The method was validated for precision, recovery, robustness, specificity, and detection and quantification limits according to ICH guidelines. Results: The HPTLC method was used to detect spots for quercetin (QC) and chlorogenic acid (CGAs) (Rf value of 0.56 and 0.37, respectively). The limit of detection (24 and 39 ng band-1), limit of quantification (72 and 107 ng band-1), recovery (99.5–99.1 and 98.9–99.6%), and precision (≤1.98 and 1.97) were satisfactory for quercetin (QC) and chlorogenic acid (CGAs) respectively. Linearity range for QC and CGAs were 100–1000 (r2= 0.9995) and 150–900 ng band-1 (r2= 0.9967) and the contents estimated as 0.87 ± 0.01% and 0.63 ± 0.01% w/w, respectively. Conclusion: This simple, precise and accurate method resolved the other constituents present in the extract. The method has been successfully applied in the analysis and routine quality control of herbal material and formulations containing M. oleifera (MO).

3. Synthesis, Physico-chemical Characterization, Biological Activity and Thermal Analysis of Novel Selenosemicarbazone Ligand and its Metal Complexes
Talib H. Mawat, Eman M. Atiyah
Abstract
Formation of four of mononuclear metals complexes derived from selenosemicarbazone Schiff-base ligand HL have been stated. The (1R,2R,4R,5S)-2,4diphenyl-3azabicyclo[3.2.1]octan-8-imine reaction with a mixture of KSeCN and NH2NH2 in aca. 1:1:3 mol ratio has led to the isolation of novel selenosemicarbazone ligand (Z)-2-((1R,2R,4R,5S)-2,4-diphenyl-3-azabicyclo[3.2.1]octan-8ylidene)hydrazine-1-carboselenoamide (HL). The HL reaction with Mn(II),Cu(II),Ni(II), and Zn(II) ions has led to isolation of new complexes with general formula K2[ML2Cl2] and [M`L2], M= Mn(II) and Ni(II); M`=Cu(II) and Zn(II). The physico-chemical methods were used to indicate the expected structure and type of bonding of ligand and the metal complexes. The analytical and spectroscopic studies of complexes have shown the isolation of octahedral, square planar and tetra-hedral geometry about Mn(II), Ni(II) and Cu(II) and about Zn(II)ion, respectively. The biological evaluation of ligand and its metal complexes have been found against the strains of the Gram(-) bacteria; Escherichia coli, and Klebsiella pneumoniae and Bacillus sabtuius, as well as the strains of the gram (+) bacteria S. aureus, which has shown the fact that metal complexes potentially het a higher level of resistivity to microbial activities in comparison with free ligand. In addition to that, the seleno-semicarbazone ligand as well as its complexes have been tested against 4 species of fungus (which are Candida glabrata, Candida albicans, Candida parapsilsis and Candida tropicalis) that has shown, in general, the fact that the complexes get a higher level of activity in comparison with free ligand HL.

4. Docking: A Powerful Approach for the Discovery of Anti-cancerous Drugs
Khushboo Kohli, Neha Sharma, Avijit Mazumder
Abstract
The discovery of drug and its development is a labor-intensive, time-consuming, and costly process. Customarily it was hard to choose the best synthetic moiety of accumulating that assumes a powerful job in treating or forestalling malignancy. In India, the death rate is extremely high in this way, the advancement of novel and intense anti-cancerous drugs is vital and henceforth, we need to apply different computational techniques for lead age and streamlining during the time spent medication disclosure along these lines. We utilize atomic mooring as it saves time just as the expense and assists with deciding little particles based leads with better pharmacological action and lessening results for an explicit sickness objective. Docking helps distinguish proof of novel accumulates of restorative interest. This survey depicts different kinds of mooring, different virtual products utilized for mooring, steps associated with mooring utilizing autodock 4.2, and how it is generally utilized in anti-cancer examination.

5. 1,2-Naphthaquinolinc-4-Sulphonate Sodium as Reagent for Spectrophotometric Determination of Rivoglitazone
Inam J. Radhi, Ahmed A. Al-Khafagi, Mohammed K. Kahlol, Muthana S. Mashkoor
Abstract
A simple, sensitive, & accurate spectrophotometric technique for quantifying Rivoglitazone is devised. The technique is based on the amino groups’ interaction in medicines with the reagent 1,2-Naphthaquinolinc-4-Sulphonate Sodium (NQS). The products’ spectra exhibit maximum absorption at 459 nm and beer’s law is seen for concentrations ranging from 0.3 to 25 ppm, with a molar absorptivity of 1.94103 L.mole-1cm-1 and limit of detection (LoD) 0.34 ppm with quantitative limit (LoQ) 1.138 ppm to the above drug. Tհe percent recoveries are 99.87, and the relative standard deviation RSD% is 0.103. Stabilitу constant is 1.07×1013 with stoichiometrу drugs to reagent 1:2. The technique was successfully applied to Rivoglitazone tablets & utilized to investigate the effects of various surfactants on the determination procedure.

6. Gene Expression of kfu gene of Klebsiella Pneumonia Isolated from Clinical and Environmental Samples
Munqith A. M. Al-Mousawi, Wathiq A. H. Al-Daraghi
Abstract
The rise of multidrug-resistant Klebsiella species is a serious worldwide problem. Klebsiella pneumoniae has been identified by the World Health Organization as a worldwide priority pathogen in desperate need of next-generation medicines. In comparison to other gram-negative infections, K. pneumoniae accumulates a larger variety and frequency of antimicrobial-resistant genes. for molecular detection the kfu resistance gene. The genomic deoxyribonucleic acid (DNA) of K. pneumoniae isolates was extracted using a wizard genomic DNA purification kit, The genomic DNA collected was examined. using 1% agarose gel electrophoresis, and the concentration and quality of the isolated genomic DNA were determined using a Nanodrop spectrophotometer device. To detect K. pneumoniae isolates using molecular methods, genomic DNA extraction of these isolates analyzed (2.5%) kfu. Susceptibility testing was performed on all K. pneumoniae (28) isolates against a panel of eighteen different antibiotics using the VITEK 2 Compact system. The findings indicated that the isolates were resistant to tetracycline (100%). To study the gene expression of kfu in K. pneumoniae, total RNA was isolated from K. pneumoniae using the TRIzol purification kit and converted to cDNA before being submitted for further amplification to investigate the gene expression of kfu gene using the RT-qPCR methodology before and after treatment with Chalcone. The findings described the gene expression of kfu in connection to housekeeping genes; the gene demonstrated changes in Ct and Folding values after being treated with various concentrations of Chalcone (0.125 g/mL). This result implies that the bacteria’s growth rate was increased to boost the gene expression of kfu after treatment with Chalcone.

7. Assessment of Acute Toxicity of Convolvulus arvensis Methanol Extract
Atheer S. Alsabah, Khulood S. Salim, Ghaith A. Jasim
Abstract
Background: Cancer incidence spread widely in the world. The findings of a promising natural product that may function as adjuvant therapy in cancer treatment as a food supplement have a very important impact on tumor development prevention. Objective: The study’s objective is to test the activity of methanol extract of Convolvulus arvensis, showing cytotoxic activity against the tumor. Methods: The plant’s leaves of C. arvensis were dried, crushed into a fine powder, and extracted with methanol, which revealed cytotoxic activity. Its safety was evaluated on two animal species, mice and rats. Toxicity was assessed in Swiss albino mice by giving them several oral doses of plant extract ranging from 1.0 to 20.0 gm/kg and watching them for four hours and then watching them every 1-hour for one day, then every six hours for another two days (72 hours, acute toxicity). The animals were also given a single dose of 5 gm/kg plant extract, biochemical markers, relative organ weights in laboratory animals (male & female rats), and the body weight was used to determine toxicity. Results: Methanol extract had an LD50 of 1.08 gm/kg. There were no significant variations in biochemical findings when compared to the control group. Throughout the trial, there are no notable weight changes. Conclusion: Methanol extract has a low LD50 (1.08 gm/kg), but there is no observed mortality or toxic manifestations during acute toxicity study. The study also approved non-significant variations in body weights, relative organ weights, or biochemical testing between the animals that received the extract and the animals used as control.

8. Design, Molecular Docking, Synthesis and Preliminary Evaluation of the Antimicrobial Activity and Stability against β-lactamases of Dipeptides Linked to Cephalexin
Yasir F. Muhsin, Ayad K. Khan, Shaker M. Alwan
Abstract
Bacterial infections have a large effect on public health. Some bacterias are innately resistant to certain classes of antibiotics, either because they lack the target or are impermeable to the drug. Others are innately susceptible but develop resistance by one of a growing variety of mechanisms. Synthesis of new derivatives of cephalexin that may have improved antibacterial, broader spectrum of activities, resistance against certain β-lactamases and/or pharmacokinetic properties. These derivatives include the incorporation of certain dipeptides at the amino group of cephalexin molecule. The dipeptides to be used are: valine-boc-tryptophan, alanine-boc-tryptophan, valine- boc-histidine, alanine-boc-histidine. The incorporation of dipeptide moiety on the acyl side chain very close to β-lactam ring may widen the spectrum of activity. This chemical addition act as isosteric group to the alkoximino that protect Beta lactam ring from bacterial beta lactamase enzyme. These new derivatives were successfully synthesized with reasonable yields show some resistance against β-lactamases and improve the pharmacokinetic properties. This approach may give new life for old drugs namely, cephalosporins and penicillins that contain amino group at the acyl side chain close to β-lactam ring. The chemical structures of these derivatives were confirmed by infrared (IR), proton nuclear magnetic resonance (HNMR) spectroscopy and elemental analyses, molecular docking, swiss ADME software. All the synthesized compounds were subjected for preliminary evaluation of antimicrobial activity using well diffusion method, against certain microbes.

9. Adsorption Study of Cephalexin Monohydrate Drug in Solution on Poly (vinyl pyrrolidone-acryl amide) Hydrogel Surface
Waleed K. Abdulsahib, Hussam H. Sahib, Makarim A. Mahdi, Layth S. Jasim
Abstract
This study has implications for physical pharmacy, medical, and biochemistry due to its use of surface chemistry. This paper describes how drug-adherent hydrogels and their pH levels influence drug adsorption on Poly (vinyl pyrrolidone-acryl amide) Hydrogel Surface. The adsorption phenomenon was examined as a function of temperature (5, 15, 25, and 37.5oC). The temperature of the solution increased adsorption of cephalexin. H2O on the surface has increased as the temperature increased, the adsorption uptake of cephalexin.H2O increased on hydrogel (endothermic adsorption). Basic thermodynamic functions for the adsorption process were calculated and used for the interpretation of the results. Using the Freundlich and Temkin models, the results show that the drug had full applicability for adsorption on hydrogel. The adsorption isotherms have an S-shaped configuration, which was determined by Giles’ classification. Freundlich isotherm n-value was found to be 2.057, meaning good adsorption.

10. Isolation and Identification of Terpenes in Euphorbia tirucalli Cultivated in Iraq
Farah A. K. A. Abbas, Maha N. Hamad
Abstract
The plant Euphorbia tirucalli, which belongs to the family Euphorbiaceae has many medicinal uses. It is used in folk medicine in East Africa, Malaysia, India, and Brazil to treat different diseases. It has many pharmacological activities such as anticancer activity, antioxidant, antimicrobial, antiviral, hepatoprotective and central nervous system (CNS) depressant. This project provides the first comprehensive research done in Iraq to study the phytochemicals and the extraction and isolation methods from E. tirucalli cultivated in Iraq. Objective: The study aims to investigate terpenes of the leaves and the root of E. tirucalli since no phytochemical investigation had been done for the plant previously in Iraq. Furthermore, to investigate if the Iraqi soil and weather might affect the existence of the terpenes in this plant. Method: The leaves and the root of the plant were defatted separately in n. hexane for 24 hours. The defatted materials were extracted in 80% methanol using the hot method (soxhlet) and the cold method (maceration), then the crude extracts were fractionated using different solvents according to the increasing in polarity petroleum ether, chloroform, ethyl acetate and n-butanol. The hexane fraction for the leaves and the root, chloroform fraction for the leaves and the ethyl acetate of the leaves were analyzed by thin-layer chromatography (TLC) and high-performance liquid chromatography (HPLC). Furthermore, gas chromatography-mass spectrometry (GCMS) was used for further analysis for the hexane fractions. Preparative high-performance liquid chromatography was used to isolate the terpenes from the hexane fraction of the leaves. The isolated compounds were identified by using analytical TLC, analytical HPLC, Fourier-transform infrared spectroscopy (FTIR), ultraviolet (UV), high-performance compact mass spectrometer (CMS). Results: The different chromatographic and spectroscopic results revealed the presence of beta-sitosterol, euphol and stigmasterol in the hexane fraction of the leaves and the plant’s root.

11. The Effect of Angiotensin Converting Enzyme activity on Resistin and TLR-4 levels in Hypertensive Subjects with or without Type 2 Diabetes Mellitus
Mustafa K. Al- Taie, Rayah S. Baban, Mouayed B. Hamed
Abstract
Background: Hypertension (HT) and type 2 diabetes mellitus (T2DM) are the most prevalent chronic disease in the Iraqi population, leading to increasing heart disease, kidney problem, and coronary artery disease or atherosclerosis. One of the famous cause of the chronic diseases like hypertension and T2DM is obesity. Resistin (RETN) is a principle hormone link between obesity and Type2 Diabetes Mellitus (T2DM) because it induces insulin resistance. It is one member of cysteine-rich secretory proteins family. A putative receptor for RETN is TLR-4, it is conceder immunomodulators of the immune response. Immune responses participate in arterial hypertension. A case-control study was conducted to estimate the relation between serum Toll-like receptor 4 (TLR4) level and serum resistin (RETN) levels with angiotensin converting enzyme (ACE) activity in patients with hypertensive subjects and hypertensive patients with T2DM. We also studied the effect of angiotensin converting enzyme inhibitor (captopril 50 mg) on Resistin and TLR-4 levels in hypertensive subjects with type 2 diabetes mellitus. Objectives: Study the effect of ACE activity on serum level of RETN and TLR-4 and their association between the Resistin hormone and its receptor in hypertensive subjects with or without T2DM subjects, and study the effect of Angiotensin Converting Enzyme Inhibitory on serum level of RETN and Toll-like receptor4 (TLR4) in hypertensive subjects with T2DM using captopril 50 mg treatment. Materials and Method: A case-control study was conducted from September 2019 to July 2020 at the Department of Chemistry and Biochemistry, College of Medicine in Al-Nahrain University on 90 subjects classified into three groups; each group consists of 30 patients. Study subjects ages will be matched in all three groups and their gender (Men) Age range was between (40–48) years old. This group consists of 30 patients with hypertension, 30 hypertensive patients with T2DM and 30 hypertensive patients with T2DM using captopril drug. For all the subjects in the research serum RETN and TLR-4 were estimated by using enzyme-linked immunoassay (ELISA) technique. Also ACE were estimation by using a spectrophotometric assay. Results: Serum resistin and its receptor TLR-4 were higher in hypertensive patients with T2DM subject than in hypertensive patients. In addition, serum Angiotensin Converting Enzyme (ACE) activity was higher in hypertensive patients with T2DM subject than in hypertensive patients. Furthermore, a positive correlation was found between TLR4 and resistance in hypertensive patients with T2DM subject group. Conclusion: The Results indicated that ACE inhibitor (captopril) decreases the serum levels of Resistin and TLR-4 in hypertensive subjects with T2DM. Moreover, evaluation the serum level of ACE activity, RETN, and TLR4 in all studies groups.

12. Investigation of the Role of VDR C>A rs7975232 SNP in the Incidence of Osteoporosis in Iraqi Women
Elham F. Hamzah, Maha F. Smaism, Alaa H. Al-Algawy
Abstract
Background: Osteoporosis (OST) effects on both men and women but women usually have a higher risk of osteoporosis than men due to women having lower bone mass, pregnancy consuming a large amount of calcium and other nutrients, and mainly the cease of estrogen secretion by ovaries after menopause which precipitates rapid bone loss. This ovarian aging is accompanied by a gradual decline in follicular pool and a further decline in estrogen production. Aim: To the evaluation of the role of VDR C>A rs7975232 SNP in the incidence of OST Iraqi women. Methods: Vitamin D concentrations were estimated by high performance liquid chromatography (HPLC) and genetic analysis were assessed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Results: The results showing highly significant (p < 0.05) of VD levels (ng/mL) on VDR SNP C>A rs7975232 in different genotypes of OST and control groups, the mean ± SD of VD in were compared depending on AA, Aa, and aa genotypes The results of amplification and digestion by restriction enzyme (ApaI) of intron 8/exon 9 of VDR gene by PCR-RFLP assay were of two alleles AA (C/C) allele with two bands and has molecular size of 532 and 214 bp and aa (A/A) allele has single band 746 bp, and Aa (A/C) was digested by ApaI (RE) into three bands 746, 532, and 214 bpConclusion: The results of the present study give additional evidence that vitamin D deficiency is significantly associated with ApaI SNPs of VDR and may be associated with susceptibility of opioid substitution therapy (OST) incidence in Iraqi women.

13. Phytochemical Investigation of Euphorbia tirucalli Cultivated in Iraq, and Isolation and Identification of Scopoletin and Quercitrin in the Plant Leaves Extract
Farah A. K. A. Abbas, Maha N. Hamad
Abstract
The plant Euphorbia tirucalli which belongs to the family Euphorbiaceae has different medicinal uses. It is used in folk medicine in East Africa, Malaysia, India and Brazil for the treatment of different diseases. It has many pharmacological activities such as anticancer activity, antioxidant, antimicrobial, antiviral, hepatoprotective and central nervous system (CNS) depressant. This project provides phytochemicals investigation and the methods of extraction and isolation from E. tirucalli cultivated in Iraq. Objective: The study aims to investigate the chemical constituents of the leaves and the root of E. tirucalli. furthermore, isolation and identification of coumarins and flavonoids from the leaves extract. Method: The leaves and the root of the plant were defatted separately in n. hexane for 24 hours. The defatted materials were extracted in 80% methanol by using the hot method (soxhlet) and the cold method (maceration), then the crude extracts were fractionated by using different solvents according to the increase in polarity petroleum ether, chloroform, ethyl acetate and n.butanol. The hexane fraction for the leaves and the root, chloroform fraction for the leaves and the ethyl acetate of the leaves were analyzed by thin-layer chromatography (TLC) and high-performance liquid chromatography (HPLC). Preparative layer chromatography (PLC) was used for the isolation of the phenols compounds from the chloroform and ethyl acetate fractions of the leaves. The isolated compounds were identified by using analytical TLC, analytical HPLC, high-performance thin-layer chromatography (HPTLC). Results: The different chromatographic and spectroscopic results revealed the presence of scopoletin in the chloroform fraction while quercitrin in the ethyl acetate fraction of the leaves of the plant.

14. Loading of Pemetrexed on Synthesized Fullerene C60 as a Promising Buckysomes
Ali I. A. Mahdi, Nidhal K. Maraie, Ashour H. Dawood
Abstract
Objective: This study utilizes C60 fullerene to prepare a new carrier (Buckysomes) for pemetrexed (for the first time) and investigate the contribution of such conjugates on the behavior, release, and anticancer activity against lung cancer cells through cell line study. Methods: fullerene C60 was synthesized by laser irradiation of polycyclic hydrocarbons (PAHs) and loaded with pemetrexed (PMX). The pemetrexed loaded on fullerene C60 was evaluated by fourier transform infrared spectroscopy (FTIR), power x-Ray diffraction (PXRD), scanning electron microscopy (SEM), atomic force microscopy (AFM), differential scanning calorimetry (DSC), particle size analyzer, and zeta potential. The percentage of drug loading, in vitro release, and anticancer activity against lung cells A549 were also evaluated. Results: Characterization technique showed the successful loading of pemetrexed on fullerene C60 nanocarrier, S9 was the optimum sample with percentage of yield reach to 90.17. Release profile shows that the percentage release of pemetrexed after 240 minutes equal 40% from pure PMX, while the release after 240 minutes was found to be 55% from pemetrexed loaded fullerene C60 nanocarrier, it is reached to 91.7% for pemetrexed loaded on fullerene nanocarrier versus 72% for pemetrexed at the end of 24 hours release. pemetrexed loaded on fullerene nanocarrier (S9) shows lower IC50 (1.03 μM) and higher cytotoxic effect than that of pure PMX (3.1 μM) and blank fullerene (75.5 μM) on A549 cancer cell at different times of exposure (24, 48, and 72 hours). The anticancer activity of pemetrexed against lung cancer cells A549 was improved upon loading on fullerene nanocarrier (80% cell death for S9) in comparison with the free drug (60% cell death) at 24 hours, although the fullerene showed limited anticancer activity (20% cell death after 24 hours) indicating that the loading process led to improve the cytotoxic activity of the drug for the tumor cells. Pemetrexed loaded on fullerene nanocarrier (S9) at 24 hours shows a higher percentage of cell death (52%) than the native pemetrexed (35%), this could be attributed to the synergistic effect of fullerene on the cytotoxic effect of pemetrexed in its complex (S9) which may lead to faster onset of action Conclusion: This work succeeded to prepare Buckysomes for pemetrexed using fullerene C60 that may act as a promising nanocarrier for pemetrexed since it produced enhancement of anticancer activity, solubility and release profile.

15. Thermodynamic Studies of Ni+2 Complexes with 4-nitrobenzoyl-carbarmothioyl-Histidine (HL)
Taghreed B. Alwan
Abstract
In this research, the prepared ligand and its complexes were studied by studying the effect of temperature between 25 to 45oC and different concentrations on the values of molar conductivity from the application of Arinus’ law, through which we determine the uniform molar conductivity and decomposition constant, thermodynamic parameters (ΔS, ΔH, and ΔG) were calculated and discussed. The results show that molar conductivity increases with increasing temperature and decreases with concentration increase through a solvent dimethylsulfoxide (DMSO). The dissociation process is exothermic process for complexes (M+2 = Ni).

16. Molecular Identification of Aspergillus nigar Using Randomly Amplified Polymorphic Deoxyribonucleic Acid Polymerase Chain Reaction Technique
Marwan Q.AL-Samarraie, Ashwak I. AL-Obaedi, Noor M. A. Hamed, Adnan F. AL- Azzawie
Abstract
The study group was chosen from the five patients, reviewed at the Consulting Department of Otorhinolaryngology in Samarra Hospital and private clinics in Samarra, who numbered five samples from December 2018 and swabs were taken from the ear with external otitis. All samples were examined directly and planted on the SDA medium and after its growth it was examined microscopically and the use of several tests to confirm the type. The polymerase chain reaction (PCR) technique and the PSK primers PKS F CCCAGTTCGGTTTTGCACTG, PKS and PKS R GCCCGTCAGTAACATGGGAA (307bp) and PCR amplification were used for molecular identification of Aspergillus nigar. The results demonstrate the degree of genetic dimension between the five A. nigar isolates. The genetic dimension values identified the genetic connection between the different genotypes of the Aspergillus spp., with the investigated species separated into one group. When they were isolated from the same source, the first and second samples were genetically closer to the remainder of the samples in this group (0.890). The genetic distance between the third and fourth samples is 0.734 and 0.647, respectively. However, molecular analyses utilizing random primers and the RAPD-PCR technique revealed some differences between the samples in this group, attributable to DNA sequencing alterations.

17. Maternal and Fetal Outcome among Pregnant Women with COVID-19 in Falluja, Iraq
Rasha S. Mahmood, Suzan A. Zidan, Mohammed I. Dawood
Abstract
Background: During pregnancy, the respiratory system undergoes physiological changes like increased congestion and secretions of the upper airways, increase in the transverse diameter of the chest wall with an elevation of the diaphragm and this make pregnant woman more susceptible for infection. Objective: To assess the possible association between COVID 19 infection and fetomaternal outcome. Patients and Method: This descriptive study includes 60 pregnant females admitted at Al-Fallujah Teaching Hospital for Maternity and Children, Iraq. Blood samples were collected from pregnant women and sera were analyzed using COVID-19 IgG/IgM rapid test. All positive cases (60 cases) during the study period were followed for two weeks for fetal and maternal complications. Results: Our study showed that 38.3% of the infected pregnant women have no symptoms, and 8.3% develop severe symptoms. There was one maternal death (1.67%). Our study showed that COVID-19 infection does not increase the miscarriage rate (5%). However, the current study showed a higher incidence of intrauterine fetal death (6.7%) in comparison with that in pregnancy in general (3.9%). All the adverse maternal and fetal outcomes were significantly associated with severe COVID-19, and asymptomatic pregnant women or those with mild or moderate symptoms have no added complications due to COVID-19 infection. Conclusion: Pregnancy does not cause worsening of the COVID-19 course. Apart from the increased risk of intrauterine fetal death, pregnant women with COVID-19 infection do not cause a higher adverse fetal outcome.

18. The Prevalence of Thyroid Autoimmunity (Anti-thyroid Peroxidase and Anti-thyroglobulin) in Sera of Iraqi Women with Polycystic Ovaries
Rafal A. Saleh, Eman G. Salih, Marwan M. Ibrahim, Nihad K. Tektook
Abstract
Background: Thyroid disorders and polycystic ovarian syndrome (PCOS) are the commonest endocrine disturbance in Iraqi womankind. Patients and Methods: During the period August 2019 to March 2020 collected about 75 blood samples from women 50 patients, aged 18 to 39 years, married, and 25 healthy women as control, who applied to Salah Al-Din Health hospital, Salah Al-Din, Iraq, was inclusive in our study. Estimation levels of antithyroglobulin (anti-TG), anti-thyroid peroxidase (anti-TPO) by used CL900i. Results: The study considered age range of 18–39, about 38% of patients with polycystic ovaries were in age group (<30 years), while about 62% in age group (≥30 years), as well as serum Anti-TPO level, was significantly higher among cases than controls. In contrast, no significant difference was detected among controls and patients concerning anti-TG. Conclusion: About 38% of patients with polycystic ovaries were in age group (<30 years), so Serum Anti-TPO level was significantly higher among cases than controls. In comparison, no significant difference was detected among controls and patients concerning for Anti-TG.

19. [Retracted]Synthesis of Sodium Alginate-g-poly(Acrylic acid-fumaric acid) hydrogel and Application as Adsorbent of Amoxicillin from Aqueous Solution
Abstract
Retracted

20. A Histological Study of the Effect of Strawberry Juice on Reducing Cholesterol-induced Effects in White Male Rats and Treating Renal Failure
Wurood M. Mutar, Rasha H. Ayub
Abstract
This study was conducted from March-May 2021. It included 4 groups of male albino rats for 60 days. The high level of fat leads to kidney injuries and failure in its functions. Whereas, the group treated with 2% cholesterol in the diet showed a significant increase (p < 0.05) in the levels of low-density lipoprotein (LDL), total cholesterol (TC), triglyceride (TG), and body weight. There was no significant difference between the other groups. Whereas, treatment with strawberries at a concentration of 7 mL/kg per day led to returning the cholesterol level to almost normal levels. The administration of strawberry juice led to the treatment of kidney tissue from the damage caused by high cholesterol to the renal tubules, renal glomeruli, and Henle loops, and returned them to their normal position.

21. Evaluation of the Vitamin D Level and Cardiac Parameters in the Blood Serum of Patients with COVID-19
Adeeb M. F. Al-Samaria, Nora S. A. Aljaff
Abstract
The study was carried out to evaluate the vitamin D, Troponin (Tn) and Cardiac Parameters (LDH, CK) for patients with COVID-19. 90 serum samples were conducted in the study with ages ranging between (35–70) years, 55 samples for patients infected with COVID-19 collected from Tikrit General Teaching Hospital in Salah Alden, and 35 samples for healthy individuals a control group. The study includes the determination of serum plasma D-dimer and serum C-reactive protein (CRP), vitamin D, troponin, lactate dehydrogenase-LDH and creatine kinase-CK. The results of this study showed a significant increase in the level of D-dimer in the blood plasma who infected with COVID-19 compared to the healthy group, and the results also showed that a significant increase in the level of CRP and Troponin, LDH, and CK in the blood serum of people infected with the emerging coronavirus compared to healthy people. As well as a result also showed that a significant decrease in the level of vitamin D in the blood sera of people infected with the emerging coronavirus compared to healthy people.

22. New Azo Ligand Synthesis, Characterization, and Bacterial Inhibition Investigation as a Derivative of 4,5-diphenylimidazole with Some Transition Metal Ions
Israa N. Witwit, Maryaim K. Al-Waili
Abstract
New (E)-4-((4, 5-diphenyl-1H-imidazole-2-yl)diazenyl)-N, N-diethylaniline (DPIED) ligand was synthesized by coupling reaction between N1, N1-diethyl benzene-1, 4-diamine, and 4, 5-diphenyl imidazole, and characterized by mass, and 1HNMR. The coordination behavior of this ligand was studied with Co(II), Ni(II), Cu(II), and (IIB.) ions utilizing Fourier-transform infrared (FTIR), ultraviolet–visible (UV-Vis), community health nursing (CHN), Atomic Absorption, Magnetic susceptibility, and molar conductivity, as well as the optimal pH and the effect of time on the stability of the complexes, were studied. Also, the values of stability constants were calculated depending on the mole ration (M:L), which was equal to (1:2). The previous results referred to suggested the octahedral shape for all of the complexes in which (DPIED) behaved as bidentate give a general formula [M (DPIED)2Cl2]. Finally, the ligand and its complexes were shown good inhibition ability towards Escherichia coli comparing with Staphylococcus aureus and Klebsiella pneumonia.

23. Synthesis and Preliminary Antimicrobial Activity Evaluation of New Amide Derivatives of 2-aminobenzothiazole
Halah A. Sahib, Zainab A. Dakhel, Mohammed K. Hadi
Abstract
Heterocyclic chemistry takes part a crucial role in drug development. Accordingly, novel heterocyclic compounds of 2-aminobenzthiazole were synthesized and tested against the microbial activity. Carbamoyl chloride of benzothiazole (compound M) was prepared, then coupled with other heterocyclic thiol derivatives through s-alkylation reaction to give compounds (MH1, MH2, MZ1, MZ2). Characterization of these compounds was done using Fourier Transform Infrared Spectroscopy (FTIR), and 1HNMR analyses. The antimicrobial results showed that all compounds at concentration 250 μg/mL, except compound MH1, have moderate activity against “the gram-negative Escherichia coli”. Furthermore, compounds (MZ1 and MZ2) are moderately active against “the gram-positive Staphylococcus epidermidis”. Finally, only compound MZ1 have moderate activity against “the gram-positive Klebsiella pneumonia”.

24. Antibacterial, Antibiofilm and Anticancer Activities of Ethyl Acetate Extract of Bacillus spp.
Haneen A. I., Neihaya H. Z., Ali Alhammar
Abstract
Bacillus spp. can produce a wide range of metabolites with important biological activities and extensively used in many applications. About 40 soil samples were collected from different gardens in Baghdad city, and only 52 bacterial isolates were identified. Thirty-eight (73.1 %) of isolates were Bacillus spp. which were: Bacillus cereus (21; 55.3%), Bacillus subtilis (11; 28.9%), and Bacillus amyloliquefaciens (6; 15.8%). B1 and B16 isolates belong to B. cereus and B. subtilis, respectively, were selected to perform the subsequent tests. Biofilm formation varied among the tested pathogenic bacteria. Fourier transform infrared spectroscopy (FTIR) analysis of B1 and B16 ethyl acetate extracts showed functional groups of secondary metabolites with major peaks belong to COOH, C-H, O-H CO-N, and N-H stretches. While, gas chromatography–mass spectrometry (GC-MS) analysis of B1 and B16 extracts revealed multiple active compounds (cyclopentan, hexane, phenol, 2,2-methylenebis, L-proline, propanoic acid, oxalic acid-isobutyl pentyl ester, pyrrolo pyridazine and octadecenoic acid). Interestingly, B16 and B1 extracts showed high activity against Staphylococcus aureus and S. pyogens, and moderate activity against Klebsiella spp., Escherichia coli, and Serratia marcescens with no effect on Pseudomonas aeruginosa. Antibiofilm activity of B16 and B1 extracts showed high inhibition against Streptococcus pyogenes and moderate on S. aureus, E. coli and K. spp., while low effect on S. marcescs and no effect on P. aeruginosa. Anticancer activity was also observed by exposing ethyl acetate extract, produced by B1 and B16 against breast cancer cell line MCF7 at different concentrations.

25. Effects of Emodin and Salvianolic Acid on Carbon Tetrachloride (CCl4)-induced Lung Fibrosis in Mice Model
Haitham M. Kadhim, Ahmed M. T. Al Mosawi
Abstract
Pulmonary fibrosis (PF) is a chronic, progressive illness associated with poor prognosis and morbidity, defined by an abnormal buildup of fibrotic tissue in the lungs parenchyma. The current study aims to assess the invivo emodin and salvianolic acid antifibrotic activity on lung fibrosis. Forty mice were divided into five groups; The first group is composed of eight healthy mice to be a negative control group, while the remaining thirty-two mice had received 1-mL/kg intraperitoneal carbon tetrachloride (CCl4) twice weekly for six weeks. Then, eight of these mice were sacrificed to be a positive control group, while the remaining twenty-four mice were divided into three groups, the first group received six every other day intraperitoneal doses of emodin 40 mg/kg and the second group received silymarin 20 mg/kg while the third group received salvianolic acid by the same route. Mice lungs were taken and examined histopathologically to assess the antifibrotic effects. Fibrosis is reduced significantly in histopathologic sections in the emodin and salvianolic acid groups. Antifibrotic effects of emodin can be due to nuclear factor-ĸb lowering, decrease of epithelial mesenchymal transition, TGF-ß1 Smad signaling suppression, Toll-like receptor-4 (TLR-4) pathway inhibition, and hematopoietic stem cells (HSCs) inhibition. The antifibrotic effects of Salvianolic acid can be due natural killer cells activation, nuclear factor erythriod-derived 2-like 2 up-regulation, transforming growth factor-β1 inhibition. Both agents (Emodin and salvianolic acid) have a comparable antifibrotic activity to that of silymarin, alleviating lung fibrosis.

26. Synthesis, Docking Study and Antitumor Activity of New Pyrido[1,2-a] Pyrimidine Schiff Base Derivatives as Non-classical Antifolate
Rafid M. Hashim, Monther F. Mahdi, Inam S. Arif
Abstract
Pyrido[1,2 a]pyrimidine Schiff base derivatives not reported previously were synthesized, and their chemical structures were confirmed by physicochemical and spectral characterization. The synthesized entities were evaluated for their antitumor activity against (MCF-7) cells by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) method, with methotrexate (MTX) positive control. Compounds 1 and 5 show the highest results. In silico docking study was performed using gold software to evaluate the inhibitory effect of synthesized entities on human Dihydrofolate reductase and Thymidylate Synthase enzyme. Furthermore, these compounds were also tested for their cytotoxicity against MCF-10 cells confirming their non-toxic behavior against normal cells and selectivity towards cancerous one. The pharmacokinetic parameters were also evaluated in silico, indicating an excellent oral bioavailability.

27. Hyperuricaemia and Inflammatory Markers in Patients with Chronic Kidney Disease
Manal A. Aziz, Abdulkareem. S. Diab, Wafaa. H. Al-Hussainni
Abstract
Background: Increased serum uric acid (SUA) level is associated with joint damage and has been positively correlated with various diseases such as chronic kidney diseases (CKD) due to inflammation. This study aimed to investigate the relationship between hyperuricemia (increased SUA) and inflammatory status in Iraqi people with different stages of CKD. Methods: A cross-sectional study recruited 128 participants with CKD (45 stage I, 42 stages II and, 41 stage III CKD patients) and 88 age-and sex-matched healthy controls. SUA, tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), interleukin-10 (IL-10), blood urea, serum creatinine, cholesterol, triglyceride (TG), low-density lipoprotein (LDL), high-density lipoprotein (HDL), and very-low-density lipoprotein (VLDL) levels were determined and compared between the groups. Results: The stage III disease group had significantly higher values of SUA, TNF-α, IL-6, creatinine, triglyceride, and blood urea levels (p < 0.0001), as well as HDL (p < 0.001), and VLDL (p < 0.05) in comparison to the controls. No significant differences in serum cholesterol, LDL, and IL-10 were found between the stages I, II and III CKD patients and controls. Conclusion: This study found CKD (stage III) patients had higher SUA. Hyperuricemia is a potential risk factor for CKD progression. These findings propose that SUA may play a critical role in inflammatory status in stage III CKD patients.

28. Corrosion Inhibition of Pure Aluminum in Acidic Media Using Expired Drug Deoxycyclin
Ahmed N. Abd, Eman S. Nasif
Abstract
Weight loss, technique were used to investigate the inhibitory effect of expired drug molecules, deoxycyclin, on aluminum pure corrosion in 0.5 M H2SO4 solution, at (293.15, 303.15, 313.15 K). When the concentration of inhibitor is increased, the inhibition efficiency improves. The Langmuir isotherm model governs adsorption. So the inhibition efficiency depends on absence and presence of the inhibitor. the highest inhibition efficiency of 93.25% was obtained at the highest inhibitor concentration and highest temperature.

29. Formulation and In-vitro Evaluation of Thermosensitive Ciprofloxacin HCL In-situ Gel for Local Nasal Infection
Omar S. Salih, Mowafaq M. Ghareeb
Abstract
Objective: A major concern about multi-site targeting is whether or not the nasal cavity is a viable route for delivering a broad range of medicines, from tiny molecules to biological macromolecules. Ciprofloxacin hydrochloride is a crystalline powder that is almost colorless. Slightly soluble in water with amphoteric properties in the form of a pKa of 6.09 for carboxylic acid and 8.8 for nitrogen on the piperazinyl ring, and the drug is 2.5% and has a pH of 3 to 4. In situ gel is a polymer solution in liquid form when applied to the mucosa. Once the solution is applied to the mucosa, it is transformed into a semisolid gel phase. Methods: Seven were developed for various parameters for assessment. Results: At physiological temperature, the gelation time for F1 and F5 was not achievable with gelation time for F3 and F4. With F3 and F7, a more tightly packed gel structure was found with the organization in a lattice pattern. Formulations containing Pluronics and chitosan demonstrated greater strength than formulations with chitosan/ethylcellulose or chitosan/chitosan ratio, which had the ethylcellulose/chitosan ratio as well as other factors in common. The interaction of chitosan with Pluronics may result in a greater molecular weight of hydrophobic molecules. It was discovered that the formulations’ medication release percentage was 71 to 91% in the first eight hours. After seven hours, the total percentage of medication permeated through the sheep nasal membrane was 78%. Conclusion: The improved formulation consisted of F3 and F7, both of which were safe for regular nasal administration, with the additional benefit of possessing required mucoadhesive strength and a temperature of 34°C for phase transition.

30. Genetic Polymorphisms of CD28 in Iraqi Patients with Behcet’s Syndrome
Samah K. Yahya, Shahlaa M. Salih, Yasir W. Issa
Abstract
Background: Behçet disease (BD) is a long-lasting systemic inflammatory disease considered through repeated cutaneous, ocular, and urogenital ulcers, vascular, gastrointestinal, neurovascular, and arthritic participation. Immune checkpoints are membrane molecules regulators of immune activation in usual biological conditions, preserving homeostasis of the immune system and preventing auto-immunity as CD28 and CTLA4. The study’s goal was to clarify the correlation between CD28 genetic polymorphisms in Iraqi patients and BD susceptibility and the impact of genetic polymorphism on soluble CD28 in Behçet’s. Methods: A case-control study on 50 BD patients with 40 controls was conducted to determine the correlation between CD28 gene polymorphisms (rs3116496 C/T) using primers specific probe and RT-PCR amplification and estimation serum level of soluble CD28 by ELISA technique. Results: The BD patients showed an elevated level of soluble CD28. The odds ratio and confidence interval (CI) 95% CI for the CC was 1.83 (0.80–4.21), TC was 0.52 (0.22–1.20), and TT genotypes was 1.21 (0.20–7.47) respectively with no significant differences between patients and controls in genotype and allele frequencies of rs3116496 SNP (p > 0.05). Conclusions: Higher levels of soluble CD28 support their role as positive T-cell regulator molecules and therapeutic target. Genetic polymorphisms in CD28 showed no association with BD. To support these results, additional cases should be investigated in further studies.

31. Impact of Metformin on Pro-inflammatory Cytokines and Histological Evaluation of the Liver Induced Diabetes on Albino Male Rats
Abeer M. A. Rasool, Isam H. Mahmood
Abstract
This study aimed to assess metformin effect with different concentration and duration on pro-inflammatory factors serum and tissue of liver and its impact upon the liver of diabetic albino rats. Metformin is administered in multi doses at various times to diabetic rats. Alloxan injected to induced diabetes in the rats, and then metformin was administered by gavage; then blood and tissue collected to analyze the biochemical parameters (a pro-inflammatory cytokine), serum blood glucose, body weight blood, and tissue were collected. Liver tissues were collected for histologic analysis at the beginning of experiments day 0, days 7, days 21, and days 35 (end of experiments) and sacrificed three animals for each period. The findings metformin-treated diabetic rat showed significant changes observed in terms of body weight and food intake behavior. Metformin treatment dropped serum blood glucose levels in diabetic rats. Following metformin treatment, an ELISA assay indicated dropped levels of pro-inflammatory markers in the liver tissues and serum. Further, metformin treatment reduced the intensity of liver inflammation measured by pathologists blindly. Conclusion: The results of reducing pro-inflammatory cytokines in the liver tissues and serum recommend the anti-inflammatory effects of metformin to improve inflammation.

32. Synthesis, Characterization of Poly (chitosan nano-particles-co-pyruvic acid) and Substitution with Different Amino Acids
Sana H. Awad, Fatimah A. Hussein, Seenaa A. Mustafa
Abstract
Carriers of bio-degradable nano-particulate are of significant potential applications for nano-particles (NPs) therapeutic range size molecules administration from about 1 to 1000; NPs can be prepared from materials diversity including polysaccharides, metals, and proteins. NPs are beneficial in biodegradability, bioavailability, purity, and relatively small cost. The current study aim was to describe novel bio-degradable NPs characterization and synthesis according to chitosan in this research preparation of chitosan (NP)-co-pyruvic acid) and substitution with different amino acid. These derivatives were characterized by Fourier-transform infrared spectroscopy (FTIR), Scanning electron microscope (SEM), Sodium triphosphate (STPP), thermal stability, and biological activity was studied.

33. Synthesis and Characterization of Sustainable Co-polymers Using a Series of Methacrylate Monomers and β-myrcene
Maysoon I. Ahmed, Ali S. Ismail
Abstract
This paper describes the synthesis and characterization of sustainable polymers using β-myrcene monomer as a terpene compound. These polymers were synthesized using an environmentally benign emulsion copolymerization method, three monomers were used: isodecyl methacrylate, isobutyl methacrylate, and cyclohexyl methacrylate, each of which was polymerized separately with β-myrcene monomer. All these polymers can be vulcanized latex, which can be used to make semi-synthetic rubber. Ammonium persulfate was used as an initiator, sodium dodecyl sulfate SDS as an emulsion, and sodium bicarbonate as a pH regulator to synthesis the copolymers in a 50/50 ratio. Fourier transform infrared (FTIR), proton nuclear magnetic resonance (1H-NMR) and carbon-13 nuclear magnetic resonance (13CNMR) spectroscopy were used to characterize the synthesized copolymers, the spectra results indicated that their signals correspond to the chemical formula of the copolymer. The glass transition temperature means that the polymer is rubbery in nature, and the glass transition temperature values are similar to those of homogeneous methacrylate polymers, it was discovered that the length of the side chain of methacrylate monomers affects the polymerization reaction, and the optimum conditions for this reaction are 60°C for 20 hours.

34. Density Functional Theory and Docking Studies of Schiff Base Complexes of Thiazole
Hasan S. Mohammed
Abstract
We optimized and determined frontier orbitals, highest occupied molecular orbital (HOMO), and lowest unoccupied molecular orbital (LUMO) energy) of Schiff base of thiazole (L) and its complexes of Cu(II) and Zn(II). Calculations were carried out using density functional theory (DFT) for thiazole (L) and its complexes with 6 to 31G* and LanL2DZ basis sets, respectively. The gap energy between HOMO and LUMO was small for the complexes and higher for Schiff base of thiazole (L). This means the Schiff base of thiazole is more stable than complexes Since the docking studies on coordination compounds are rare, we studied Schiff base of thiazole ligand and its copper and zinc ions complexes. We used Molegro virtual docker (MVD) software to predict the inhibition activity of thiazole and its complexes against 2MUJ in plasmodium falciparum. These molecules exhibited a MolDock score of (-272.1 to -397.1) kcal/mole and a re-rank score in (-91.4 to -198.1) kcal/mole. All studied molecules exhibit good docking results, but the best one is the copper complex.

35. Isolation of Novel Lupeol and Acetoside from Iraqi Campsis grandiflora Flowers and Evaluation of their Anti-inflammatory Effect on the Animal Model
Sarah S. Hasson, Ibrahim S. Abbas, Bahir A. R. Mshimesh
Abstract
Campsis grandiflora (Bignoniaceae) is a fast-growing deciduous climber, native to central and southern China. The dried flowers have been used as a carminative, blood tonic, and febrifuge in Chinese traditional medicine. This plant has an anti-inflammatory, anti-oxidant, anti-depressant, and anti-bacterial effect, beneficial in stagnant blood and endometriosis. In this study, the detection of lupeol and acetoside was performed using thin layer chromatography (TLC) and high-performance liquid chromatography (HPLC); while the isolation done by preparative layer and column chromatography using hexane and butanol extract of Iraqi C. grandiflora flowers. Spectral analysis by Fourier-transform infrared spectroscopy (FTIR) and Nuclear magnetic resonance (NMR) was done for the two isolated phytochemicals. Furthermore, the anti-inflammatory activity of total ethanolic extract and one of the isolated compounds (acetoside) was assessed using an egg-albumin induced acute inflammation and formalin-induced subacute and chronic inflammation within mice model, compared with diclofenac. The results showed that the hexane and butanol extract of Iraqi C. grandiflora flowers contain lupeol and acetoside, respectively, and from our knowledge, this is the first novel study that suggested the presence of lupeol in the C. grandiflora flowers extract. Moreover, the total extract of this plant possesses a moderate anti-inflammatory activity against the acute inflammatory model and an excellent anti-inflammatory activity against the subacute and chronic inflammatory models. In conclusion, the anti-inflammatory effect of Iraqi C. grandiflora total extract attributed partly to caffeic acid derivatives, i.e., acetoside, and other phytochemicals such as terpenoids produce an additive or synergistic effect with acetoside.

 

36. Preparation and In-vitro Evaluation of Floating Bilayer Tablets of Nefopam HCL as an Oral Modified Release Dosage Forms
Wisam Sanad, Shaimaa N. Abd-Alhammid
Abstract
Nefopam hydrochloride is a non-opioid analgesic used for acute and chronic pain. Formulation of this drug as a floating tablet could be a good choice because of no need for advanced preparation methods and also gives an accepted extended-release in the gastric media to get rid from multiple daily doses. Adding a bilayer technique means the immediate part with quick dissolution impacts a first analgesic effect with a sustained release from the floating part. In this study, all three preparation methods used direct compression, dry granulation, and wet granulation with different polymers and effervescent materials in different concentrations from all these trials. Only 14 formulas met the criteria of accepted floating part from them only one was taken to be immerged with an immediate release layer to get the best bilayer floating design. All the formularies pass through ordinary pre and post-compression floating tablet characteristics with different results that permit more comparison between different formulas giving us more knowledge about the nature of drugs, polymers, additives, and method of preparation. The formula called WEN2 contains (HPMC E15 150 mg, Carbapol943 22.5 mg, sodium bicarbonate 45 mg, and tartaric acid 22.5 mg) prepared by wet granulation chosen for best formula design.

37. Preparation and Evaluation of Pharmaceutical Cocrystals for Solubility Enhancement of Dextromethorphan HBr
Zainab E. Jassim, Khalid K. Al-Kinani, Zahraa S. Alwan
Abstract
Purpose: To study the cocrystal formation between dextromethorphan HBr and a selected conformer, tartaric acid, as a method of improving the physicochemical properties especially the solubility of dextromethorphan HBr which was selected as a model drug. Methods: Different methods were used to prepare cocrystals of dextromethorphan HBr such as co-grinding; liquid assisted grinding, and solvent evaporation methods at different molar ratio (1:1, 1:2 and 1:3). Characterization of the prepared formulation was done using saturation solubility, drug content, Fourier transform-infrared (FTIR) spectroscopy, differential scanning calorimeter (DSC), In vitro dissolution study, Powder X-ray diffraction (PXRD), and scanning electron microscopy (SEM). Results: Saturation solubility study revealed an increase in the solubility of drug dextromethorphan HBr, especially in F9 prepared by the solvent evaporation method. FTIR studies confirm the formation of hydrogen bonds in the selected formula, F9, with a noticeable shift in the vibration bands. Thermal analyses by DSC demonstrated the formation of new species, a cocrystal having melting points that is different from its components. The formation of cocrystals was also confirmed by PXRD denoting the crystallinity of formed cocrystals through the observation of new intense peaks with 2θ value difference. The formulations containing the prepared cocrystals showed an improvement in the dissolution rate with marked enhancement in the drug solubility. Also, SEM analyses exhibited micrographical variation typical to cocrystals, suggesting the generation of a new solid phase. Conclusion: The study showed that the described solvent evaporation method can be used as a simple method to prepare cocrystals at molar ratio 1:3 to enhance the solubility of sparingly soluble drug represented by dextromethorphan HBr.

38. Synthesis and Characterization of New Quinoline-2-ones Derived from Triazine Derivatives
Sahar F. Abbas, Jumbad H. Tomma
Abstract
The work involves the synthesis of new four types from quinolin-2-one derivatives [IV]a-d. starting with 5,6-diphenyl-1,2,4-triazine-3-thiol. Benzil was reacted with thiosemecarbazide in glical acetic acid to give compounds [I], which was reacted with chloroethyl acetate and fused sodium acetate in ethanol to get compound [II]. The condensation of ester[II] with hydrazine hydrate led to producing new acid hydrazide [III]a The reaction of acid hydrazide [III]a with coumarin compounds led to formation quinolin-2-one derivatives [IV]a,b. On the other hand, hydrazine hydrate with ethanol were heated under reflux to produce a new hydrazineyl compound [III]b Then reaction [III]b with coumarin compounds led to the formation quinolin-2-one derivatives [IV]c,d. All newly synthesized compounds have been tested for their antibacterial activity against Bacillus subtitis gram (+)ve and Escherichia coli gram (-)ve bacteria and also on Candida albicans fungal, The synthesized compounds were characterized by melting points, FTIR, 1HNMR, and Mass spectroscopy (of some of them).

39. Synthesis, Structural Characterization and Evaluation of Antibacterial Activity of New 2-methyl-1H-benzimidazole Derivatives
Omar M. Hatroosh, Muayad A. Rdaiaan
Abstract
A new series of benzimidazole derivatives compounds containing 1,3,4-thiadiazole ring and amide group were synthesized by reaction of 2-methyl-1H-benzimidazole with 2-chloro-N-(5-(substitutedphenyl)-1,3,4-thiadiazol-2-yl)acetamide. The resulting compounds were characterized by FTIR and 1H-NMR spectral analysis, and evaluated their antibacterial activity in vitro against four types of bacteria isolates two gram-negative (Staphylococcus aureus and Staphylococcus epidermidis) and two gram-positive (Escherichia coli and Pseudomonas aeruginosa). Some of the synthesized compounds showed moderate to good activity against these types of bacteria.

40. Evaluation of the Anti-inflammatory and Anti-oxidant Activity of Crab Components and Crab Shell in Experimental Rats in Comparison with Dexamethasone and Diclofenac Sodium
Hadeel A.Khalaf, Ahmed H. J, Ataimish, Ammar A. Fadhil
Abstract
Crabs belong to the crustacean family (Decapods crustacean), and their shells contain natural ingredients from which the bioactive compounds are derived. It has been used as folklore medicine in cancer treatment. We investigate the possible anti-inflammatory and anti-oxidant effects for crab shells and whole crabs. Thirty-six rats (150–-200 gm) from both sexes were used, divided into six groups, the anti-inflammatory and anti-oxidant activity measured using cotton pellet induce granuloma model. Detection of TNF α, IL 1β, SOD, and MDA levels using ELISA Kits. The data analysis by one-way ANOVA followed by the Tukey test. Values are significant at (p < 0.05). The results and conclusion showed that the crude material for both crab shell and whole crab have anti-inflammatory and anti-oxidant activity with ELISA analysis.

41. Synthesis, Characterization and Antimicrobial Evaluation of Some New Azo Compounds Derived from 1, 3, 4-thiadiazole Ring
Shaymaa D. Khudhur, Tareq K. Ibraheem
Abstract
New 1, 3, 4-Thiadiazole derivatives containing azo group were synthesized by the reaction of 1, 3, and 4-Thiadiazole derivatives prepared from benzoic acid thio-semicarbazide to give various derivatives of 1,3,4-Thiadiazole derivatives. The resulting compounds reacted with 1,2-dibromomethane in the presence of K2CO3 and acetone as solvent produce compounds. These compounds were characterized by melting point, Fourier-transform infrared (FT-IR), proton nuclear magnetic resonance (1H-NMR) and Carbon-13 nuclear magnetic resonance (13C-NMR) and evaluated their antibacterial activity in-vitro against four types of bacteria isolates two gram-negative (Staphylococcus aureus and Staphylococcus epidermidis) and two gram-positive (Escherichia coli and Pseudomonas aeruginosa). Indeed, the synthesized compounds showed moderate to good activity against these types of bacteria.

42. Formulation and In-vitro Evaluation of Super Porous Hydrogel Composite of Baclofen
Haidar E. Jeleel, Fatima J. Jawad
Abstract
Baclofen (BCN) is a centrally acting muscle relaxant that act by inhibiting the transmission of the reflexes at the spinal cord level. It is used to treat spastic movement particularly in the case of spinal cord injury and multiple sclerosis. The major objective of the present study is to formulate a gastroretentive drug delivery system of super porous hydrogel composite (SPHC) of baclofen to increase its residence time in the stomach to increase its absorption because baclofen has a narrow absorption window limited in the stomach and upper part of small intestine. Gas blowing technique is the method used for the formulation of different formulas of baclofen super porous hydrogel composite by using polymers such as acrylic acid 40%, acryl amide 40%, and poly vinyl alcohol (PVA) in different amounts of 10, 15, 20, 25 and 30 mg, the positive and encouraging results was obtained by the using of acryl amide (AM) and PVA as a monomers. N, N-Methylene-Bis-Aacrylamide (MBA) used as a cross linker. Crospovidone (COP) used as a composite agent. Sodium bicarbonate has been used as the CO2 generating agent to assist to the formulation. The effect of monomer and cross linker agent amounts on the percent of drug release has been studied. The formulas were investigated for their swelling ratio, mechanical strength, porosity, density, drug content and drug release. The formula of 30 mg PVA, 300 μL of 40% AM, 50 mg CRP and 50 mg Sodium bicarbonate has a mechanical strength of 277gm with a percent of drug release reached to 98.5% within 12 hours. that indicate a sustained release of the baclofen drug. The selected formula then evaluated for scanning electron microscopy and fourier transform infrared spectroscopy (FTIR) study to investigate the compatibility of the drug with the polymers used and the results showed there is no incompatibility between the drug and the materials used.

43. Synthesis and Characterization of Co-polymer of (Albumin-PVP) as Carriers for Different Antibiotics
Sana H. Awad, Faris Hamood, Sana A. S. A. Kareem
Abstract
In this work, a new drug polymer was prepared from the reaction of Albumin with polyvinylpyrrolidone (PVP) and maleic anhydride and substitution with different antibiotics. It is used to treat several bacterial infections. Modifications of drug delivery to redirect the antibiotic of the circulation and target it to cells, tissues, or organs where infection happens might lessen the chance for the Fluor quinolone to travel to bone and cartilage. This plasma protein can transmit medicines like ibuprofen, warfarin, naproxen chlorpromazine, and Binding of the composites to change albumin, their targeting influence, and circulation time. Study the properties physical of polymer-drug was characterized via hydrogen nuclear magnetic resonance (HNMR), Fourier transform infrared spectroscopy (FTIR). The controlled release rates of polymer-drug were studied in several values of pH of four days at 37oC and the thermal stability of drug-polymer.

44. Determination of Phenobarbital and Pipenzolate-methylbromide in Spastal Oral Drop by High-performance Liquid Chromatography Method
Baidaa A. Jassim, Ali I. Khaleel
Abstract
An accurate method has been developed to determine phenobarbital (PHB) and pipenzolate methyl bromide (PMB) in pure form and in pharmaceutical preparations using high-performance liquid chromatography (HPLC) technique. 20 μL of a solution of the drugs with a concentration of 15 μg/mL of PHB and PMB were injected using an L1 (150 mm × 4.6 mm. 5 μ) separation column at a temperature of 25ºC and acetonitrile: methanol: phosphate buffer (55:10:35) v: v: v as a mobile phase at a flow rate of 1 mL/min and detection at a wavelength of 200 nm. The Linearity of the method ranged from (2.5–50) μg/mL and (2.5–45) μg/mL, the retention time was 4.156 minutes and 6.5 minutes, the detection limit was 0.005 μg/mL and 0.0006 μg/mL, the average Rec% was 99.376% and 99.675%, and the correlation coefficient was 0.9997 for PHB and PMB, respectively. This method was successfully applied for the determination of (PHB) and (PMB) in the pharmaceutical preparation (spastal drop).

45. Assessment of Oxidative Stress Biomarker (8-OHdG) and Paraoxonases 1 in Type II Diabetic Mellitus
Zainab M. Attia, Hanan J. Hammood, Mohammed A. Assi
Abstract
Objective: The purpose of this research was to shed light on oxidative damage by determining the concentrations of 8-hydroxy.2 deoxyguanosine (8-OHdG) and the antioxidant enzyme paraoxonase-1 (PON1) at diabetes patients with DM II. Methods of Study: From September 6 to December 4, 2020, (45) patients with diabetes mellitus from (120) people were assessed in the education of Diwaniyah hospital. The study includes measurement of the body mass index, fasting blood glucose level, HbA1c, lipid profile and Levels of oxidative stress parameter 8-OHdG and antioxidant enzyme (PON-1). Results: These findings were made public. The 8-OHdG level in the diabetic group was considerably higher (8.963.96 pg/mL) than in the control group (6.073.31 pg/mL; p 0.01). our observations were appeared in diabetes individuals, there was a substantial increase in blood cholesterol, triglycerides (TG), low-density lipoprotein (LDL), very-low-density lipoprotein (VLDL) concentration, and a significant drop in high-density lipoprotein (HDL) levels at p.value (0.05) when compared to healthy controls. Conclusion: 8-OHdG level were high at diabetes group than in the healthy groups, suggesting that 8.OHdG could be used as a more sensitive early disease marker. This is important because 8OHdG is a strong indicator of DNA damage caused by oxidative stresses in blood vessels as well as other organs. This increases the risk of heart problems.

46. Synthesis and Biological Activity of New Sulfonamide Derivatives
Alhamzah D. Hameed, Atheer A. Y. Al-Fatlawi, Anees A. Y. Al-Fatlawi
Abstract
The widespread of resistance to antibacterial agents that became threatening made it essential to search for new antibacterial agents with new mechanisms of action. Different amino acids, dipeptides, and polypeptides derivatives were synthesized and tried as antibacterial agents, some of which were found to possess antibacterial activity. Five derivatives were prepared, the Ethyl-Para amino benzoate, ethyl 4-(phenylsulfonamido) benzoate, N-(4-(hydrazinecarbonyl) phenyl) benzene and N-(4-(2-(4-(dimethylamino) benbenzylidene) hydrazine carbonyl) phephenyl) benzene. The methods used for the identification of synthesized derivatives include elemental analysis, thin layer chromatography, infrared spectroscopy and melting point determination. The Preliminary study of antimicrobial activity for the target compounds showed that the compounds (4 and 5) had no activity against Staphylococcus aureus, while showed moderate activity against Escherichia coli, when compared to Ciprofloxacin. These compounds are thus promising targets for further research in the antibacterial wide field.

47. Comparative Diagnostic Study of Streptococcus dysgalactiae Isolated from Cow’s Milk by using Media, Biochemical Tests, VITEK 2, and Polymerase Chain Reaction
Azhar A. Neamah, Khilood H. Fahad, Jenan N. Sadeq, Monyer A. A. Al-Fatlawi
Abstract
The current study aims to investigate compassion among the four most common diagnostic methods used for the detection and isolation of Streptococcus dysgalactiae. It included the media culture (Columbia Horse Blood Agar), classical identification (biochemical tests), VITEK 2 assay, and polymerase chain reaction (PCR) in the detection of S. dysgalactiae taken from bovine milk. Fifty samples of milk samples are collected from cows randomly (healthy and unhealthy cow), then kept in the sterile tubes and sent to the microbiology laboratory for detection by the above methods. All the used methods test all the samples in our study. These methods are included culture on Columbia horse blood agar, biochemical tests, compact bacterial identification system (VITEK 2) assay, and PCR. Our results showed that the percentage of S. dysgalactiae isolated from cow’s milk using culture on Columbia Horse Blood Agar was 14/50 (28)%. The percentage of S. dysgalactiae isolated from cow’s milk using the biochemical tests was 12/50 (24)%. Furthermore, the percentage of S. dysgalactiae isolated from cow’s milk using the VITEK 2 system was 11/50 (22)%. Finally, the percentage of S. dysgalactiae isolated from cow’s milk using PCR was 10/50 (20)%. Besides that, sensitivity and the specificity of the culture on Columbia horse blood agar were (42.85) and (88.88), respectively. The sensitivity and the specificity of the biochemical tests were 58.33 and 92.1, respectively, and the sensitivity and the specificity of the VIITEK 2 assay was 81.81 and 97.43 respectively. However, the PCR method considered the gold test in the study. The current study considered the detection by PCR method are a standard golden test, and suggest the VITEK-2 assay is more sensitive compared with other methods, followed by the biochemical tests method and media culture on Columbia Horse Blood Agar methods.

48. Novel Carbon Paste Electrode for Determination of Cefixime in the Pharmaceutical Formulations and Human Fluids
Dina H. Haider, Bashaer A. Al-Aphalahy
Abstract
The novel and very sensitive potentiometric sensor were made with excellent electrochemical properties using carbon paste electrodes to determine Cefixime (CFX). The electrodes were produced using the ion-pair compound of Cefixime-crystal violet (CFX-CV) as the electroactive component and plasticizers Tris (2-Ethylhexyl) phosphate (TEHP), Di-butyl phthalate (DBPH) and Di-butyl phosphate (DBP). The slope of Cefixime (CFX) electrodes gave a Nernstain response equal to 55.33, 41.61 and 42.88, mV/decade for electrodes A, B and C, respectively with a linear range of (1×10-5–1×10-2), (5×10-5–1×10-2) and (1×10-5–1×10-2) M, respectively, a detection limit of 9.8×10-6, 4.6×10-5 and 8.9×10-6 M, a lifetime of 62, 12 and 9 days, respectively. Electrode A offers the best results; therefore, it was specifically chosen for the application of pharmaceutical and human fluids. The recovery percentage was 103, 98, 93, and 95 for Cefixime capsules (400 mg), Cefixime oral suspension (100 mg/5 mL), urine and plasma by standard addition method, respectively.

49. Effect of Anti-oxidant Activity of Kiwi Fruit Against Oxidative Stress Induced by Hydrogen Peroxide in Male Mice
Qaysar A. Obaid, Khudhair A. M. Abed AL-Ani, Rafid J. Kadhum
Abstract
Kiwi fruit is among the most valued fruits in the world due to its flavor and health advantages. This study is carried out to assess the anti-oxidant and beneficial effect of kiwi fruit on some biochemical and blood parameters in male mice exposed to oxidative stress. Thirty (30) male mice were randomly distributed into three groups (group contained ten mice). The first group was considered as a control group (C), second group T1 [0.75% hydrogen peroxide (H2O2)] received in drinking water for 30 days, and the third group T2 treated with oral administration with 250 mg/kg aqueous extract of kiwi fruit and received H2O2 (0.75%) in drinking water daily for 30 days. The results clarified that male mice received H2O2 induced oxidative stress causes significant (p < 0.05) elevation alkaline phosphatase (ALP), alanine aminotransferase (ALT), aspartate aminotransferase (AST), creatinine, urea, and bilirubin, while a reduction in glucose level and total protein on biochemical parameters. In addition, it has a deleterious effect on hematological parameters through reduction of red blood corpuscle (RBC), hemoglobin (Hb), hematocrit, mean corpuscular hemoglobin (MCH), and white blood cell (WBC). The result clarified the anti-oxidant effect of kiwi fruit in group T2 manifested by enhancement biochemical and hematological parameters compared to T1. It could be concluded that kiwi fruit possessed anti-oxidant and protective activity on a biochemical and hematological parameter of the oxidative stressed male mice.

50. Effect of Autologous Eye Drops in Ocular Surgery
Tayseer K. A. M. Al-Saadi, Mohammed Q. Y. M. Al-Atrakji, Khudair A. J. Al-Taiyawi
Abstract
Aim of the Study: To evaluate the effects of the autologous eye drops with conventional treatment in patients with ocular surgeries. Method: This is a single center prospective and interventional study evaluating the effects of 20% autologous eye drops after Corneal collagen cross-linking with riboflavin; It was conducted on sixty patients were recruited from Ibn AL-Haithem Teaching Eye Hospital from study included patients with keratoconus who were previously diagnosed and suitable for cross-linking surgery. All patients with keratoconus had accelerated corneal collagen cross-linking surgery and received conventional treatment, Patients were randomized into two groups. (study group n = 30) who received autologous eye drops as a 20% and (control group n=30) who received artificial tears drops. All patients had been seen in first, third, fifth, and seventh day of surgery to evaluated the following parameters: epithelial closure time, fluorescein test, pain score, visual acuity, postoperative opacity. Result: The study includes 60 patients (30 autologous serum group as a study group, 30 artificial tears group as control). Mean ages were 23.83 ± 5.08 years in the autologous group and 25.47 ± 4.99 years in the artificial tears group (p = 0.214). There was no significant difference in sex between control and study, in comparison visual acuity between two groups; autologous patients had a best corrected visual acuity. Mean pain scores was statistically significantly difference, autologous group show lower mean pain scores in all the days of follow-up. On the 5th day, 28 (93.3%) patients in the study group had a complete closure, and in control group 7 (23.3%) patients with complete epithelial closure. On the first day after surgery, two patients in the autologous serum group and four in the control group had ocular haze. Conclusion: After corneal collagen cross-linking, using autologous serum eye drops speeds up epithelial healing, lowers postoperative discomfort and pain, improves visual acuity. Shortening the time it takes for epithelial closure to close might be useful in terms of decreasing complication and infection risk.

51. Synthesis, Characterization and Docking Studies of New Benzimidazole Derivatives Containing 1,3,4 thiadiazole Ring and Study of their Antibacterial Activity
Hayder M. Hajhooj, Muayad A. Rdaiaan
Abstract
A new series of benzimidazole derivatives containing 1,3,4-thiadiazole ring moiety were synthesized by nucleophilic substitution of 2-(bromomethyl)-1H-benzimidazole with some derivatives of 1,3,4-thiadiazol-2-amine compounds. The resulting compounds were characterized by various techniques like fourier-transform infrared spectroscopy (FTIR), Proton nuclear magnetic resonance (1H-NMR) and Carbon-13 nuclear magnetic resonance 13C-NMR and evaluated their antibacterial activity in vitro against four types of bacteria isolates two gram negative (Staphylococcus aureus and Staphylococcus epidermidis) and two gram positive (Escherichia coli and Pseudomonas aeruginosa). Indeed, the synthesized compounds showed moderate to good activity against these types of bacteria. Docking studies of compounds (6c and 7c) on eubacterial ribosomal decoding A site (E. coli 16S rRNA A. site) (pdb:1j7t) have been conducted to find the possible mode of action of the molecules.

52. Extraction, Purification, and Characterization of Chloramphenicol Acetyltransferase from Pseudomonas aeruginosa
Nada S. Mohammed, Entesar H. Ali
Abstract
Chloramphenicol acetyltransferase (CATs) is a bacterial enzyme that detoxifies the antibiotic chloramphenicol and is implicated in bacterial chloramphenicol resistance. The acetyl group from acetyl-CoA is covalently bound to chloramphenicol by this enzyme, preventing chloramphenicol from binding to ribosomes. In this study, Pseudomonas aeruginosa was harvested to study its chloramphenicol acetyltransferase. P. aeruginosa was isolated from urinary tract infections and diagnosed morphologically, microscopically, and with VITEK 2 system. Then we examined the ability of bacteria to produce chloramphenicol acetyltransferase; initially was tested for resistance to the antibiotic chloramphenicol, and then cultured in the production media difco nutrient broth (supplemented with 1% of glycerol and addition of the substrate chloramphenicol) which was suitable for growing bacterial cells and extraction of the enzyme. Chloramphenicol acetyltransferase was extracted by ultra-sonication and then purified through precipitation with ammonium sulfate as a first purification step, ion-exchange chromatography, and gel filtration. The activity of the enzyme was measured for each purification step. Purification of chloramphenicol acetyltransferase from P. aeruginosa using ammonium sulfate revealed that the specific activity was 20 units/mg protein, and the best saturation ratio was 40%, the purification times were 1.5, and the enzymatic yield was 88.8%. Furthermore, the results of enzyme purification by using ionic exchange DEAE-Cellulose were: the specific activity was 47.5 unit/mg protein, the enzymatic yield was 88.6%, and the number of purification times was 3.7. The purification results using gel filtration Sephadex G-100 showed that the specific activity was 66.6 unit/mg protein, purification times, and enzymatic yield were 5.2 and 66%, respectively.

53. Effect of Prunus armeniaca L. Methanol Extracts on Antioxidant Enzyme Activity and Liver Function in Albino Mice
Haidar J. Mohammed, Zahraa H. M. Kadri
Abstract
In this study, we aimed to determine the effect of Prunus armeniaca L. methanol extract on antioxidant enzyme activity (AEA) and liver function in albino mice. Method: In the liver, the antioxidant activity was measured by estimating the concentration of glutathione (GSH), catalase (CAT), and Malondialdehyde level (MDA). Results: The liver total catalase level (CAT), glutathione level (GSH), and MDA results were significantly high in mice treated with apricot seeds methanolic extract at three doses (50, 100, and 150 mg/kg) group compared with control groups, while in MDA apricot seeds methanolic extract at a dose (150 mg/kg) non-significantly compared with control groups. Advancement in liver function parameters such as alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), and acitic phosphatase (ACP) compared with control. Conclusion: The results indicate that apricot seeds methanolic extract might remain a potential candidate in preventing diseases.

54. Effect of Sperm Morphology on Success Rate of Pregnancy by Intra Uterine Insemination
Wafaa S. A. Al-Amieer, Lamees A. Shubber, Farqad R. Abdulkadim
Abstract
Background: Fertility can be affected by multiple factors and have a major impact on couples’ lives. One of these factors is abnormal seminal fluid parameters. This study concentrates on sperm morphology’s impact on pregnancy rate by intrauterine insemination. Aim of Study: To evaluate the effect of sperm morphology on the success rate of pregnancy by intrauterine insemination. Materials and Methods: From 1 July 2017 to 1 November 2018, 100 couples with primary or secondary infertility, 50 with normal sperm morphology, and 50 with abnormal sperm morphology were included. History occupied from the patient, clinical examination was done. The couples had either primary or secondary infertility, so they had already did baseline investigation for Intrauterine insemination (IUI) as part of their investigation for infertility: at least 2 seminal fluid analysis saturated fatty acid (SFA), thyroid function test, serum prolactin, day 3 of cycle serum LH and FSH, E2 hormones and ovulation follow up by serial ultrasound tracing and mid-luteal serum progesterone. Either HSG or diagnostic laparoscopy assured tubal patency. The patient had day 2 Transvaginal ultrasound as a baseline for AFC and exclusion of any pathology in both ovaries. Most males are sent for urological examination and sent for the US for exclusion of varicocele or any pathology. Result: In this study, out of 100 patients, 13% got pregnant, and 87% did not get pregnant normal sperm morphology ranges from 1–100 mean value 22.82 and standard deviation ± 27.901. Half the partners had abnormal sperm morphology, and the other half had normal sperm morphology. There is no relationship between unexplained malefactors and sperm morphology as the p-value was 0.799, statistically significant. No relation between varicocele and sperm morphology p-value is 0.118. No relation between oligospermia and sperm morphology p-value was 0.140. There was an association between asthenospermia and abnormal sperm morphology as the p-value was 0.037 witch is statistically significant. Conclusion: This study concluded that the success rate of intrauterine pregnancy assisted by IUI was not influenced by sperm morphology.

55. Microwave Assisted Synthesis of Schiff base derived from Salicyldehyde and 1, 4- butane diamine and Complexes with Transition Metal (Sm+3, Cu+2)
Fatime S. Shri, Haider A. Mehdi
Abstract
Schiff base as ligands and their complexes have been synthesized from 1, 4- butane diamine and salicyldehyde. The ligand and its transition metal complexes of Cu(II) and Sm (III) are characterized by Ultraviolet-visible (UV-Vis), Fourier transform infrared spectroscopy (FTIR) Proton nuclear magnetic resonance (1H-NMR), Mass, molar conductance and magnetic susceptibility measurements. The antibacterial activity of the synthetic organic compounds was tested. For both complexes, The stoichiometry has been found to be (metal : ligand) is 1:1.

56. Effects of Vaginal Sildenafil Citrate on Ovarian Blood Flow and Endometrial Thickness in Infertile Women Undergoing Intra-uterine Insemination
Muntaha A. Abdullah, Wassan A. Abdulhamed, Muayad S. Abood
Abstract
Background: Healthy blood circulation in the uterus and ovaries can affect the success of assisted reproductive therapy (ART). Ovarian Color Doppler and ultrasound blood flow assessment is a useful non-invasive technique that assesses ovarian vascular function by evaluating the ovarian stromal blood’s resistance index and pulsatility index. The resistance index is a sign of resistance to blood circulation. The lower the resistance index value, the more blood circulation. The use of vaginal sildenafil is a promising treatment to improve endometrial circulation and ovarian Doppler blood flow index to treat infertile women. Objective: To evaluate the effect of vaginal sildenafil citrate on ovarian blood flow and measured by two-dimensional Doppler ultrasound parameters (ovarian stromal blood resistance index and pulsatility index) and pregnancy of infertile women receiving termination of the intra-uterine insemination (IUI). Subjects and Methods: A total of 50 infertile patients achieved IUI and were randomly divided into two groups, the sildenafil group, of which 25 patients were included in this study and received treatment with Sildenafil citrate 50 mg (group of sildenafil) and. The second group, 25 infertile women, did not receive sildenafil (group without sildenafil). Both groups of infertile women received letrozole to stimulate intrauterine insemination was followed by continuous transvaginal ultrasound to assess the number and size of mature follicles, the thickness of the endometrium, and the ovarian stromal blood flow to measure the resistance index (IR) and the pulsatility index (PI) of the dominant ovary. Results: Patients in the sildenafil group showed (significantly) more mature follicles than the non-sildenafil group (p = 0.028). The mean endometrial thickness in the sildenafil group was also greater than the days of the human trophozoite. The group of without sildenafil was (8.90 ± 0.54 mm and 8.0 ± 0.91 mm) respectively and p = 0.001, and also had significantly lower resistance index and pulsatility index (p < 0.001) (0.41 ± 0.08 vs 0.58 ± 0.07) and (0.46 ± 0.08 vs 0.63 ± 0.07), respectively. The pregnancy rate in the sildenafil group was significantly higher than in the non-sildenafil group (p = 0.032). Conclusion: Topical sildenafil treatment significantly improved ovarian interstitial blood flow, endometrial thickness, and pregnancy rate.

57. Microwave Preparation, Spectroscopic Investigation, and Anticorrosion Evaluation of Bidentate N, O-Doner Schiff bases and its Complexes with Cu (II) and Co (II) Ions
Khalid K. Shaker, Haider A. Mehdi
Abstract
A new ligand (LH) and its complexes with Cu (II) and Co (II) were prepared. The purity of the new synthesized compound was checked by performing TLC using appropriate solvent and the spots visualized in the UV light. Ligand (LH) is characterized by using Fourier-transform infrared spectroscopy (FTIR), ultraviolet-visible (UV-vis), Proton nuclear magnetic resonance (1H-NMR) spectra, and Mass spectrum. Metal ion complexes with Cu (II) and Co (II) were prepared in a M:L (1:1) ratio and characterized by the same spectrophotometric techniques, magnetic susceptibility and molar conductivity. The new ligand showed a reasonable amount of anti-corrosion activity. It was observed that the corrosion rate (CR) in the presence of the inhibitor decreased with the increase of the inhibitor concentration at a constant temperature.

58. The Effect of Carbamazepine on Interictal Epileptic Discharges in Patients with Focal Epilepsy
Mazin M. Hammady, Shaymaa J. Mohammed, Omar S. Sabbar
Abstract
Background: According to the International League Against Epilepsy (ILAE) recommendations, carbamazepine (CBZ) is considered at the top of the first-line antiepileptic drugs in treating partial epileptic paroxysms with or without secondary generalization. The CBZ act on cortical neurons by different types of actions, electroencephalographic (EEG) examination of patients placed on CBZ therapy is of special importance due to this ability of medication, the administration of CBZ and its derivative should be scheduled concerning the form of epilepsy, specificity of individual EEG, EEG dynamics and clinical manifestation during the treatment. Objective: This study aimed to evaluate the impact of carbamazepine on interictal epileptic discharge for patients with focal epilepsy. Patients and Method: This is a prospective study conducted in Basra general hospital from first of March to first of November 2014, one hundred ten (110) patients recently diagnosed as having partial epilepsy were included in the study. Their age range from 15 to 45 years, no one of them had a history of encephalitis, meningitis, head trauma or cerebrovascular accident (CVA), with normal neurological exam and normal MRI and CT scan. All patients were exposed to EEG exam at the starting of the study by using digital EEG machine according to the 10 to 20 International system. All EEG records that presented with changes suggestive of interictal epileptic discharges (IEDs) were then independently reviewed. The frequency of IED was calculated. Patients began the drug therapy with carbamazepine (20 mg/kg/day), and a second EEG exam was done after six months. Patients who show no compliance to treatment or resistance to treatment (continue to experience clinical attacks of seizure) were excluded. All patients who missed their follow-up visits after three months of starting a treatment or did not attend the second EEG exam appointment after six months of treatment were excluded. Results: From one hundred ten patients included in the study only 77 patients continued the study and 33 patients were excluded. The results revealed that 68 patients (88.3%) had a significant reduction in mean epileptic discharge in the second EEG exam after six months of treatment with carbamazepine. Furthermore, among them, 42 patients (61.8%) had no more clinical seizure attacks during study time, and 26 patients (38.2%) continued having seizure attacks until the end of third month after starting treatment, and most of them experienced one attack during the first or second month. Conclusion: Carbamazepine is still a very effective drug in the management of partial epilepsy. Besides, EEG is an essential tool in the assessment of patient’s response to carbamazepine and reduction in interictal epileptic discharges on subsequent EEG studies may predict the chance of developing further clinical epileptic attacks in patients with partial epilepsy using carbamazepine drug.

59. Immuno Histochemical Expression of CD133 as Cancer Stem Cells Marker in a Sample of Iraqi Patients with Colorectal Carcinoma
Adyan K. Majee, Zahraa K. Zaidan, Waleed H. Yousif, Majid H. Al-Dari
Abstract
Colorectal cancer is one of the most frequent malignancies in the world, and it is also one of the most deadly. Distant metastases and recurrence frequently cause patient death. Cancer stem cells (CSCs) play a crucial role in colorectal cancer spread and relapse. CSCs are a type of cancer cell that can self-renew, divide indefinitely, and differentiate in multiple directions. The CD44, CD133, CD24, EpCAM, LGR5, and ALDH are some cell surface markers used to identify colorectal CSCs. They are highly tumorigenic, chemoresistant, and radioresistant, making them important in colorectal cancer metastasis and recurrence as well as disease-free survival. The current study included 60 Iraqi male patients. They were assigned into three groups. Group I consisted of 20 newly diagnosed colorectal cancer patients, group II consisted of 20 relapsed patients who were treated with chemotherapy and were cured, but the tumor relapsed, and group III consisted of 20 patients who demonstrated resistance to chemotherapy treatment. All clinicopathological markers were analyzed, and they demonstrated a higher tumor grade in group II compared to the other groups and a difference in age between groups. In comparison to group I, CD133 expression was higher in groups II and III, with the observation that some IHC slides were clear of typical colorectal cancer cells but positive for CD133, indicating the presence of cancer stem cells. In the resistance group, similar effects were reported. The results could be explained by the fact that the highest expression of CD133 suggests a significant number of cancer stem cells, which play a key role in tumor relapse and treatment resistance. As a result of these findings, CD133 may be employed as a biomarker for cancer stem cells, allowing for their detection and aiding in the process of tailoring therapy for these cells within the tumor mass, preventing tumor relapse and resistance to chemotherapy.

60. Detection of Virulent genes Khe, iuc, rmp, magA in Klebsiella pneumoniae Isolated from Urinary Tract Infection
Burooj M. R. Al-Aajem, Hamed M. Jasim, Ali J. Saleem
Abstract
Background: The epidemiology of virulence genes of Klebsiella pneumoniae is developing rapidly and shows noted geographic differences in genotyping distribution of genes. K. pneumoniae have more virulence factors according to encoding for many virulent genes. Aim of the Study: Detection of virulent genes Khe, iuc, rmp and magA in isolates of K. pneumoniae that caused recurrent urinary tract infection. Patients and Methods: Samples were cultured on MacConky agar, blood agar, nutrient agar and Chrom agar orientation for isolation and identification of bacterial isolates based on standard bacteriological methods, biochemical tests. And Vitek -2 was used to identify the bacterial isolates, se. Genomic deoxyribonucleic acid (DNA) was extracted using promega™ gDNA Bacteria Kit. Polymerase chain reaction (PCR amplification for detection virulence genes of K. pneumoniae Khe, iuc, rmp and magAResults: The results of PCR reaction for Khe genes showed 17 (56.66%) of K. pneumoniae contains this gene. Hemolysin considers proteins to work as exotoxin secreted by bacteria that destroy blood cells. Hemolysin gene are virulence factor for K. pneumonia to evade the immune system of the body and its break down red blood cell. The aerobactin synthase genes (iucC) is detected in 17 (56.66%%) among 30 isolates of K. pneumoniae. Moreover, results of PCR reaction don’t show any isolate of K. pneumoniae containing rmpA and magA genes. Conclusion: Molecular assay is a suitable technology helpful in estimating the virulence factors such as hemolysin gene in isolates of K. pneumoniae that help diagnose disease caused by pathogenic bacteria.

61. Effects of Estrogen in Treating Myocardial Damages Caused by Ischemia in Adult Female Rats
Kvan O. Ahmed, Ahmed H. Saleh
Abstract
This study aims to show the role show the role of estrogen in rats with ischemic heart disease. 60 adult female rats were used in the study and divided as follows into five equal groups (each group consists of 12 rats); control female rats group, second group ischemia rats without ovariectomy. Third group rats with only left ovary were removed, fourth group rats both ovaries were removed, fifth group rats with both ovaries were removed and treated (intramuscular injection) with (10 mg/kg) estrogen. The results show a significant increase (p < 0.05) in several inflammatory cells and levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST), malonedialdehyied (MDA) with significant (p < 0.05) reduce in glutathione (GSH) levels in third and fourth group compare with healthy female rats. While, after using estrogen in treatment, the outcomes exhibited non-statistic significant (p < 0.05) differences in a number of inflammatory cells, liver enzymes, MDA, and GSH compared with healthy female rats. It was concluded that estrogen has been an important role in the treatment of myocardial damages caused by ischemia.

62. Anti-Cancer Efficacy of 6 Mercaptopurine Loaded Biotinylated Cellulose Nanowhiskers
Osamah N. Wennas, Mohammed H. Mohammed, Dhulfiqar Ali Abed
Abstract
6 Mercaptopurine (6 MP) is an important drug used for cancer treatment. However, 6 mercaptopurine has many disadvantages including low water solubility, limited and variable bioavailability, and severe side effects. This work’s objective was to optimize the delivery of 6 MP by targeting it to the solid cancer tissues using an endogenous receptor system and glutathione-sensitive α, β unsaturated linker. Two 6 MP prodrugs were prepared, cellulose nanowhiskers (CNW) were used as a nanocarrier for the preparation of 6 MP-CNW-biotin (compound 12), using glutathione (GSH) sensitive linkage between the CNW and 6 mercaptopurine. The second prodrug, 6 MP-biotin (compound 9), was prepared by conjugating 6 mercaptopurine to the biotin directly using glutathione sensitive linker to evaluate the CNW role. The release assay was done in-vitro and it showed that just 11.4% of 6 mercaptopurine was released from compound 12 under glutathione at the micromolar concentration (100 μM), while the accumulative release reached 78.2% under 10 mM glutathione concentration. The in vitro cytotoxic effect was evaluated by 3-(4, 5-dimethylthiazolyl-2)-2, 5-diphenyltetrazolium bromide (MTT) assay, the results showed that compound 9 has a greater inhibitory effect on cell lines with biotin overexpression (HepG2 and MCF-7) and low inhibitory effect on biotin negative cell line (CHO). Compound 12 showed activity comparable to 6 mercaptopurine against HepG2 and MCF-7, and lower inhibitory effect on CHO.

63. Synthesis and Characterization of New Coumarin Derivatives as Possible Antimicrobial Agents
Shams S. Abdulraheem, Mohammed K. Hadi
Abstract
Umbelliferon, the natural crenelated coumarin distributed in the plants of a piaceae family, has shown various biological activities. The study aims to synthesize new coumarin derivatives, offer thorough chemical characterization, and evaluate their antimicrobial capabilities, given the potential interest of heterocyclic compounds. Two new series of 2-((4-methyl-2-oxo-2H-chromen-7-yl)oxy) acetohydrazide (III) has been synthesize: Schiff bases (N-acyl hydrazones) IV(a-c) and (VII), N-alkyl hydrazide derivatives of (III): V (a-c). Salicylaldehyde react with ethyl acetoacetate in the presence of piperidin at room temperature to produce compound 3-acetyl-2H-chromen-2-one (VI). 7-hydroxy-4- methycoumarin (I) react with ethylbromoacetate in the presence of K2CO3 and dry acetone to produce ethyl 2-((4-methyl-2-oxo-2H-chromen-7-yl)oxy)acetate (II), which then reacted with hydrazine hydrate in the presence of ethanol to produce 2-((4-methyl-2-oxo-2H-chromen-7-yl)oxy) acetohydrazide (III). These newly formed Coumarin derivatives were tested for antibacterial activity against a variety of microorganisms; two species of (G+ve) bacteria (Staphylococcus aureus, Streptococcus pneuomoniae) and two species of (G-ve) bacteria (Pseudomonas aeruginosa, Escherichia coli) and antifungal activity against Candida albicans. In the present study, the new coumarin derivatives are synthesized and characterized by attenuated total reflectance fourier transform infrared spectroscopy (ATR-FTIR) and 1H-Nuclear magnetic resonance (1HNMR) spectra. The preliminary study of the antimicrobial activity of final compounds showed that compound VII has a significant antibacterial and antifungal activity followed by compounds IVb and IVc. In contrast, compounds IVa, Va, Vb and Vc showed slight to moderate antibacterial activity and antifungal activity, except compound IVa showed high antifungal activity.

64. Tamoxifen vs. Letrozole as Ovarian Stimulants in Infertile Iraqi Women
Doaa S. Aleqabi, Huda I. Al-Qadhi
Abstract
Background: Infertility is defined as the inability to become pregnant after one year of non-contraceptive sexual activity. Letrozole, a potent, non-steroidal selective, reversible aromatase inhibitor, is considered an established treatment for ovulation induction. Tamoxifen citrate (TMX) is a triphenylethylene derivative with a structure similar to CC that has been considered for ovulation dysfunction treatment. If the female has good quality of follicles in her ovaries and no other reasons for infertility, treatment with these medications can result in conception. Objectives: This study aimed to compare the effectiveness of tamoxifen and letrozole in ovulation induction outcomes in infertile Iraqi women. Patients and Methods: This prospective randomized study was carried out from November 2020 to March 2021 on 88 infertile women, selected randomly from the infertile center in Alkut Hospital for Maternity and Childhood. The patients were divided into two groups viz. the first group (48 patients) received letrozole 2.5 mg twice daily from day 3 of the cycle for 5 days for three cycles, and the second group (40 patients) received tamoxifen 20 mg twice daily from day 2 for 5 days for three cycles. Results: The current study shows a statistically significant difference between both groups regarding the endometrial thickness, which was significantly higher in the tamoxifen group than the letrozole group. No significant difference was reported between both groups as regarding pregnancy rate, rate of miscarriage, Mean number of mature follicles ≥ 18 mm, and follicular diameter. Conclusion: Both letrozole and TMX were effective ovulation induction agents, TMX was superior to letrozole in achieving a higher Endometrial thickness.

65. Role of Quercetin Flavonoid as Antidiabetic: A Review
Hussein K. Hamid, Maithm A. Obaid
Abstract
Today hypoglycemia, kidney problem and hepatotoxicity became the main complication of diabetes mellitus (DM) and real challenges to modern medical research. New trials afford the use of herbal products obtained from plant sources considered more affordable and effective and show less adverse effects as an alternative cure for DM. Natural products like secondary metabolites have many different biological activities and attention is received to developing an anti-diabetic medication from a flavonoid compound. Numerous studies have highlighted not only the flavonoids have hypoglycemics effects, but it’s also important in managing DM complications. DM and its numerous complications are now becoming one of the serious threats to human health and also, the current available synthetic drugs used for the management of DM are neither cheap nor entirely effective. Unfortunately, these current drugs do not restore regular glucose homeostasis over a prolonged period and they are not free from side effects. Quercetin shows a good anti-oxidant activity and may improve beta-cell functions and increase insulin secretion from the Langerhans islets in pancreas, which can be considered a good alternative medical treatment for diabetic patients. The present review is an attempt to understand the biological activity, therapeutic activity and mechanism of quercetin and its eventual clinical results in field of medicine development in the diabetes mellitus management as an alternative treatment.

66. Clinical Application of Iron Oxide Nanoparticles in Dentistry: A Review
Munadle R. Hadi, Karar Najeh, Abdulsahib S. Jubran, Ibrahim J. Sahib, Haneen T. Ali
Abstract
Biotechnology, such as its application in medication, is commonly used during our everyday lives. Implementing nanomaterials (NMs), atoms, binding energies, and compounds existing within different compounds are easy to analyze and modify. Nanotechnology is being used as nano dentistry throughout the dental field. The chemical, physical and biological dimensions of iron oxide nanoparticles are taken as selecting a nanoparticle to be used in nano dentistry. To build the functional organizational structure, different atoms or molecules are also inserted. In dentistry advances or evaluation, iron oxide nanoparticles (IONPs)have been used. Including dental disease prevention medications, prostheses, and that for teeth implantation, iron oxide nanoparticles have been used. Also, iron oxide nanoparticles supply dental fluids or medications, avoid, and cure some dental problems (oral cancer), and sustain medical care to a significant level. Throughout the dental field, the whole review summarizes the use of iron oxide nanoparticles.

67. Advance Nanogels of Drug Delivery System: A Review
Ahmed Y. Fadhel, Nawal A Rajab
Abstract
The term ‘nanogels’ defined as particles in nanosized made cross-linked polymers networks by chemically or physically which is a swell in a suitable solvent. The nanogels are made up of various forms of synthetic or natural polymers that are bound together by physical non-covalent bonds such as H-bonds, electrostatic bonds, and hydrophobic bonds or by chemical covalent bond. A nanosize of nanogel is designed to reduce some of the disadvantages of micron size particles, which includ retention at targeting site, surface area, site specificity, swelling properties, loading efficiency of drug, and finally release behavior. It classifies based on responsive behavior and on the basis of linkages (physical and chemical). This review aims to provide general introduction on nanogels, their novel application in different approach and recent synthesis methodology.

68. Study of Main Factors Affecting the Leakage of Aluminum into the Food Wrapped in Aluminum Foil During Cooking
Mohammed A. Hussein, Khalid W. S. Al-Janabi
Abstract
Different cooking conditions were examined for aluminum content in food cooked while wrapped with aluminum foil. The influence of each anticipated factor (the acidity of the cooking medium, type of acids normally used in cuisines namely acetic and tartaric acids, various cooking temperatures, influence of the presence of sodium chloride salt, the effect of cooking oil, and the length of time of cooking) was studied thoroughly as a function of aluminum degraded out of the aluminum foils to the medium. The experimental samples were digested with nitric acid upon fulfillment of examining each factor separately before quantifying aluminum with the sensitive technique of atomic absorption spectroscopy. The outcomes of the study have shown that the increment in the acidity and the heat of the cooking medium have exhibited a very noticeable effect on the Aluminum content leaked out of the aluminum foil. Nevertheless, the cooking time, the presence of the salt of sodium chloride, and the oil medium compared to the aqueous have exhibited a positive influence by increasing the aluminum leakage out of the foil into the solution.

69. Influence of Pharmaceutical Care Interventions on Clinical and Biochemical Markers of Asthmatic Patients at Baghdad Teaching Hospital, Baghdad, Iraq
Marwan S. Ibrahim, Mohammed M. Mohammed
Abstract
Background: Asthma is a significant cause of morbidity and mortality worldwide. Asthma, a chronic respiratory disease characterized by chronic airway inflammation, bronchial hyper-responsiveness, and reversible airflow obstruction, poses a substantial economic burden on patients and caregivers alike. Education is a critical component in the management of asthma. Objective: This study is designed to assess the impact of pharmacist-led educational interventions on asthma control and serum levels of inflammatory and oxidative stress biomarkers. Method: Patients in this study received conventional therapy for chronic bronchial asthma, in addition to pharmaceutical care and patient education by clinical pharmacists for three months. All patients enrolled in this study were assessed clinically for asthma control test (ACT) and biochemically; serum levels of Interleukin 6 (IL-6), tumor necrosis factor alpha (TNF-α), and SOD-3 at the baseline and after 3 months. Result: At the end of the study, patients who received a pharmaceutical care plan significantly improved their asthma control by improving the asthma control test score and significant changes in IL-6, TNF-alpha, and SOD-3 levels (p < 0.05) after 3 months of follow up by a pharmacist. Conclusion: The present study results provide supportive evidence concerning pharmacists’ favorable effects on asthma patient care and support pharmacists as valuable health care team members.

70. Estimation of Visfatin Hormone Levels and Lipid Profile in Obese Patients
Zina L. Hassan, Imad S. Saleh
Abstract
This study aimed to examine the Visfatin hormone level and fats in a group of (20) obese males and (10) lean males as control. The study included measuring the Visfatin with biochemical assays; Total cholesterol (TC), Triglycerides (TG), low-density lipoprotein cholesterol LDL-C, High-density lipoprotein cholesterol HDL-C, and Very low-density lipoprotein cholesterol VLDL-C. The results showed a significant increase (p < 0.05) of Visfatin and the levels of TC, LDL-C, and VLD-C in the obese group compared to the normal group. In comparison to the research of healthy persons, there was a substantial reduction in HDL-C levels. In addition, the obese group had a significantly higher BMI than the normal group.

71. Effect of Smoking on COVID-19 Severity
Hussein A. A. Al-Baka, Doaa N. M. Al-Debi
Abstract
It is proven that smoking leads to the development of many serious diseases. In this study, we tried to show a relation between tobacco smoking and COVID-19 severity. We collected 198 COVID-19 patients reports from 4 hospitals. The patients were 151 men, 93 of them smokers, and 47 women, 11 smokers. The patients were suffering severe symptoms and were hospitalized for different periods. Some of them were admitted to intensive care units, and sometimes ventilators were necessary and used. Among the men, 4 smokers and 1 nonsmoker died. At the same time, 2 smoker women and 1 nonsmokers died. The results have been subjected to statistical analysis, and there were significant differences in the percentage of deaths.

UGC approved Journal

This journal is present in UGC approved List of Journals for the purpose of Career Advancement Scheme (CAS) and Direct Recruitment of Teachers and other academic staff as required under the UGC (Minimum Qualifications for Appointment of Teachers and other Academic Staff in Universities and Colleges)

The publication is licensed under Creative Commons License  View Legal 

Published by International Society for Science and Nature